+8 (916) 786-78-28 с 10.00 до 22.00 ежедневно

Меню

Сирийский хомяк болезни и лечение: Симптомы болезни хомяков. Это знать обязательно!

Мокрый хвост у хомяка | Мои домашние питомцы

Болезни хомяков

Наша сегодняшняя публикация будет адресована, прежде всего, владельцам сирийских хомячков (подробнее об их содержании читайте здесь). Ведь, именно эти грызуны чаще других болеют таким опасным заболеванием, как болезнь «мокрого хвоста».

О, симптомах заболевания, о том, почему хомяки им болеют, о том, как лечить сирийца, и как ему помочь — обо всём этом мы расскажем на страницах нашей новой публикации…

Почему у хомяка мокрый хвост

Поскольку, большинство наших читателей далеки от ветеринарии, особенно в области изучения заболеваний грызунов, мы не буем утруждать их специфическими ветеринарными терминами, которые бывает не так уж и легко выговорить, и тем более – понять, человеку, далекому от всего этого. Есть конкретный симптом заболевания – мокреющий хвост хомяка, и именно по этому признаку, да простят нас дипломированные ветеринары, мы и будет идентифицировать этот недуг. Итак, заболевание мокрого хвоста у хомяков – достаточно серьезное, и угрожающее жизни вашего любимца.

Объясняется это тем, что болезнь протекает очень тяжело, имеет инфекционный характер, что становится причиной высокого процента заразности – особенно опасно для тех, кто держит нескольких хомячков или занимается их разведением. Прогноз заболевания также не утешительный — высокий процент смертности, даже при условии своевременного обращения в ветеринарную клинику за помощью к специалистам. В случае же самолечения – шансов на выздоровление у хомяка, к сожалению, слишком мало.

Симптомы болезни мокрого хвоста у хомяков

Сирийские хомяки чаще других болеют этим заболеванием

Главным симптомом заболевания является именно мокреющий хвост хомяка, вернее, мокрая задняя часть тела грызуна в области хвоста и возле него. Такой мокнущий эффект возникает в результате частой и сильной диареи, которую вызывает нарушение работы желудочно-кишечного тракта сирийца. При этом, на обычную диарею, вызванную тем, что хомяк что-то не то съел (узнайте, чем лучше кормить хомяка), «мокрый хвост» не похож, поскольку выделения из заднего прохода характеризуются сильным неприятным запахом, а само поведение хомяка меняется – он становится агрессивным, раздражительным, может кусаться и царапаться, когда вы будете пытаться взять его на руки.

Некоторые отмечают за питомцем и беспокойное перемещение по клетке, взъерошенность шерстяных покровов. При этом, заболевший хомяк отказывается кушать и пить, что ещё больше оказывает негативное влияние на ситуацию, так как в результате диареи его организм теряет воду и обезвоживается.

В случае отсутствия помощи уже на начальных этапах заболевания, в 90% случаев, сирийские хомяки погибают.

Как происходит заражение

Возбудителями заболевания «мокрый хвост» являются различные бактерии, при этом, с момента их попадания в организм грызуна и до момента появления первых симптомов заболевания должен пройти инкубационный период, который составляет не менее 2-х недель. Заразиться хомяк может от своих уже больных сородичей (именно поэтому, очень важно устраивать карантин для всех заболевших грызунов и отсаживать их от здоровых, чтобы препятствовать распространению инфекции). Или вы можете принести домой из зоомагазина уже больного хомячка – опять же, очень актуален карантин для новоприбывших питомцев, чтобы они не заразили своими болезнями старожилов.

Велика вероятность заражения заболеванием и через испорченные продукты питания и не свежую воду. Одним словом, в большинстве случаев, заболевание «мокрый хвост» встречается у тех сирийских хомячков, чьи владельцы не соблюдали всех рекомендаций относительно их содержания и кормления, и не уделяют достаточно внимания чистоте в клетке.

Лечение болезни мокрого хвоста у хомяков

Как вылечить хомяка

Как мы уже писали выше, самостоятельно вылечить сирийского хомяка (узнайте о других породах хомяков) от этой болезни, если вы не ветеринар – практически невозможно, поэтому, как только вы заметили характерные для этого недуга симптомы у своего питомца – незамедлительно обращайтесь за помощью в ветеринарную клинику, рассказывайте о своих подозрениях, и позвольте специалисту осмотреть грызуна-пациента. Если ветеринар подтвердит диагноз, то хомяку будет назначен карантин, от всего, чтобы было в клетке, в которой на момент болезни жил хомяк – подстилка, еда, наполнитель, вам нужно будет избавиться. Саму клетку нужно будет продезинфицировать, не забывая обо всех её поверхностях и вспомогательных аксессуарах животного.

Касательно медикаментов, то пациенту будет назначена антибиотикотерапия (антибиотик, его дозировку и частоту приёма выбирает ветеринар), гидратационная терапия, чтобы восстановить водный баланс и избежать обезвоживания, пробиотики для восстановления здоровой микрофлоры в кишечнике… Однако, даже соблюдение всех этих рекомендаций ещё не даёт 100% гарантию того, что ваш питомец полностью восстановится и не будет в дальнейшем иметь проблем со здоровьем. Нередко, среди выздоровевших от «мокрого хвоста» сирийских хомяков наблюдается склонность к частым воспалительным процессам, осложнения в работе пищеварительной системы.

Но, не стоит терять надежду, возможно, ваш грызун попадёт в в процентное число счастливчиков, которые выздоравливают и даже приобретают иммунитет к этому заболеванию, что защищает их на всю жизнь от этого заболевания.

Профилактика болезни мокрого хвоста у хомяков

Для того, чтобы снизить вероятность заражения вашего хомяка этим страшным недугом, рекомендуется придерживаться основных рекомендаций и советов относительно ухода за ним, рациона его питания, уделять достаточно внимания чистоте и гигиене в клетке, и соблюдать правила одиночного содержания грызунов.

Несмотря на то, что это заболевание не представляет никакой смертельной угрозы для владельцев больных питомцев, не стоит забывать о собственной гигиене рук после контакта с хомяком и с его клеткой.

Видео о сирийских хомяках

Сегодня мы с вами говорили о страшном заболевании, которое чаще всего поражает сирийских хомяков (другие породы хомяков тоже им болеют, но реже), о его симптомах, о том, как происходит заражение, как лечить болезнь и как её предупредить. Надеемся, что наши рекомендации помогут вам в уходе за вашим сирийцем, и сохранят его жизнь и здоровье.

А, как часто вы убираете клетку своего хомяка? Считаете ли вы, что чистота в ней является залогом и профилактикой от многих заболеваний, которыми болеют хомяки? Поделитесь с нами своим опытом, историями и, конечно же, фотографиями ваших питомцев, которые вы можете выложить на страницах нашей группы Мои домашние питомцы, которую можно отыскать Вконтакте.

Читайте также о породах морских свинок.

Сирийский хомяк: уход и содержание

Содержание:

Миниатюрные сирийские хомячки — популярные домашние любимцы, поскольку не требуют сложного ухода. И взрослые, и дети обожают наблюдать, как забавно эти грызуны засовывают еду за щечки!

Как не допустить ошибок в содержании сирийского хомяка? Чем кормить зверька и что делать для того, чтобы не пропустить болезнь?

Основная информация

Латинское название: Mesocricetus Auratus.

Другие названия:

переднеазиатский хомяк, золотистый хомячок.

Отряд: грызуны.

Семейство: хомяковые.

Вес: 100-150 г.

Длина тела: 13-15 см.

Шерсть: короткая, длинная, рекс (кудрявая), сатин (с глянцевым блеском).

Окрасы: золотистый, коричневый, кремовый, черный, светло-серый, белый, соболиный и другие.

Средняя продолжительность жизни: 3 года.

Содержание: одиночное.

Немного истории

Впервые сирийский хомяк был описан английским ученым Джорджем Робертом Уотерхаусом в 1939 году. Тогда исследовать посчитал данный вид вымершим. Но в 1930 году израильский зоолог Израэль Ахароне опроверг это мнение: в ходе экспедиции им была обнаружена беременная самка сирийского хомяка (в том, что она принадлежит к этому виду, ученый не сомневался).

Грызун был доставлен в Иудейский Университет, где на свет появились 11 малышей. Через некоторое время, по ряду причин, у исследователя осталось всего 3 особи — 2 самца и 1 самка. Другие попытки найти в дикой природе сирийских хомяков успехом не увенчались.


Израэль Ахароне приложил множество усилий для того, чтобы возродить популяцию переднеазиатских хомяков. Так, он принял решение скрестить самку с самцом родственного вида. Полученное потомство стало родоначальником новой ветви сирийского вида хомяков. Со временем ученые пришли к выводу, что в дикой природе этих грызунов больше не осталось.

Характер

Эти миниатюрные питомцы ведут ночной образ жизни: днем хомяк преимущественно спит, в темное время суток его активность возрастает. Зверек начинает активно крутить

колесо, перетаскивать свои запасы с места на место, грызть клетку. Словом, создает достаточно много шума. Поэтому на ночь клетку с грызуном лучше убрать из комнаты, где спите вы или ваши дети.

Как правило, характер у сирийского хомяка добродушный. В этом заключается его основное преимущество перед другими видами. Его достаточно легко приучить к рукам, при этом агрессию зверек будет проявлять только в случае опасности.


Однако не нужно думать, что грызун не кусается вовсе. Это может произойти, к примеру, если сделать ему больно. Также не следует просовывать пальцы между прутьями клетки — зверек способен принять их за еду. Если у вас дома есть маленькие дети, сразу объясните им правила общения с хомяком.

Содержание и уход

Сирийские хомяки — неприхотливые в содержании питомцы. Грызуну, который поселился в вашем доме, понадобятся:


Клетка

Минимальный размер — 50х30х25 см. Лучше, если это будет многоуровневая модель, оборудованная разнообразными игровыми элементами — полочками, лесенками и тоннелями. Рекомендуется выбирать клетку с металлическими прутьями — так грызун не сможет сбежать из нее. Оптимальное расстояние между прутьями — 0,5 см.

В комнате, где стоит клетка, должна поддерживаться температура воздуха от 17 до 22 градусов, влажность воздуха — 55-70%. Не располагайте жилище хомяка вблизи радиатора отопления и под прямыми солнечными лучами.


Подстилка

Подстилка — это наполнитель, которым устилают дно клетки. Материал должен быть гипоаллергенным и обладать высокой степенью впитываемости. Подходящие варианты — опилки, древесные гранулы для грызунов. Газету использовать не рекомендуется — типографская краска может вызвать у грызуна аллергию или отравление.

Важно! Проводить генеральную уборку в клетке необходимо минимум 2 раза в неделю — удалять остатки пищи, менять подстилку, промывать клетку и поддон.


Колесо

Это не просто развлечение, а настоящий спортивный снаряд, необходимый зверьку для того, чтобы поддерживать себя в хорошей физической форме. Размер бегового колеса подбирается индивидуально, с учетом габаритов питомца.



Кормушка и поилка

Кормушку лучше выбирать напольную — так любимцу будет проще доставать из нее еду. Рекомендуем остановиться на стеклянной или керамической модели — такую кормушку трудно перевернуть. Что касается поилки, то сирийским хомякам удобнее употреблять воду из ниппельной.

Важно! Воду в поилке необходимо менять ежедневно!


Домик

Хомячки — животные норные, поэтому предпочитают прятаться в укромных местах. Домик станет для любимца надежным укрытием от внешнего мира и удобным местом для отдыха.


Туалет

Для туалета хомяки обычно выбирают конкретное место в клетке. Поэтому в эту зону можно установить пластиковый угловой лоток-туалет — это облегчит уборку.

Кормление

Сбалансированное ежедневное питание — залог здоровья и активной жизни грызуна.

Основу его рациона должны составлять зерновые смеси — именно ими зверек питался бы в дикой природе. Готовые сухие рационы содержат необходимый набор витаминов, минералов и микроэлементов.

Оптимальный размер порции зернового корма — 2 столовые ложки. Кормить переднеазиатского хомяка нужно дважды в день — утром и вечером, желательно в одно и то же время.

Конечно, одних зерновых смесей недостаточно. Рацион хомяка следует разнообразить растительной пищей — дополнительным источником витаминов.

Совет! Приобретите в зоомагазине набор для выращивания травы. Сочные ростки точно понравятся питомцу!

В свободном доступе у сирийского хомяка всегда должен быть минеральный камень — он не только является источником необходимых микроэлементов, но и способствует стачиванию зубов.

Можно периодически баловать маленького любимца лакомствами:

  • фруктовыми палочками;
  • зерновыми палочками;
  • медовыми крекерами;
  • печеньем;
  • сушеными овощами и фруктами;
  • и другими.

В рационе хомяка должна присутствовать и белковая пища, необходимая для формирования мышц. Подойдут, к примеру, сушеные лакомства — сверчки, гаммарус, мучной червь и другие.



Здоровье

Обычно сирийские хомяки отличаются крепким здоровьем. И все же и они не застрахованы от болезней.

Важно! Большинство заболеваний у грызунов возникают вследствие ненадлежащих условий содержания и неправильного питания.

Чаще у сирийских хомяков диагностируются:

  • вирусные и бактериальные инфекции;
  • паразитарные заражения;
  • лимфоцитарный хориоменингит;
  • инфекционный гастроэнтерит;
  • расстройства желудочно-кишечного тракта;
  • конъюнктивит.

Важно! Некоторые инфекционные и вирусные заболевания могут передаваться от хомяка человеку!

Иногда у грызунов возникает такая неприятность, как воспаление защечных мешков. Оно возникает вследствие механической травмы. Поэтому рекомендуем обращать внимание на то, что хомяк запихивает за щеки — некоторые предметы могут нанести вред его здоровью.


Изредка владельцы сирийских хомяков сталкиваются с проблемой излишне длинных зубов у любимца. Это бывает, если в клетке грызуна отсутствует минеральный камень для стачивания зубов. Однако эта неприятность легко решается в условиях ветеринарной клиники.

Природа наградила переднеазиатских хомяков не слишком крепкой нервной системой, поэтому любой стресс или испуг может привести к печальному исходу. Постарайтесь сделать так, чтобы маленького любимца не беспокоили резкие громкие звуки и другие домашние питомцы (особенно кошки).

Ежедневно осматривайте грызуна для того, чтобы не пропустить развитие опасных заболеваний. Вас должны насторожить следующие симптомы:

  • нарушения работы желудочно-кишечного тракта: рвота, диарея, понос;
  • выделения из глаз, ушей;
  • снижение аппетита;
  • повышенное слюноотделение;
  • ухудшение качества шерсти — шелушение, залысины;
  • нарушение координации движений;
  • судороги.

Если вы заметили у любимца один или несколько тревожных симптомов, рекомендуем обратиться к ветеринарному врачу-ратологу.

Вопросы и ответы

Можно ли содержать несколько сирийских хомяков в одной клетке?

Нет. Эти грызуны — одиночки по своей природе, которые не терпят посягательств на свою территорию. Поэтому в клетке может спокойно жить только один хомяк.


Как приручить сирийского хомяка?

Это несложно — они способны привыкнуть к рукам за несколько дней. Желательно начинать приручение в темное время суток, во время активности зверька. Не следует брать грызуна в руки против его воли, удерживать за голову.



Будет ли от хомяка неприятно пахнуть?

Переднеазиатский хомяк — чистоплотное создание, которое само по себе не имеет запаха. Если от клетки неприятно пахнет, значит, уборке не уделяется достаточно времени.


Обязательно ли покупать

клетку?

В советское время, ввиду дефицита некоторых товаров, хомяков держали в трехлитровых банках. Однако ограниченное пространство плохо сказывалось на здоровье грызунов, и продолжительность их жизни значительно сокращалась. Сирийскому хомяку необходима просторная клетка, оборудованная различными снарядами для поддержания физической активности — колесом, лесенками, тоннелями и т.д.

Интересные факты о сирийских хомяках

1. Эти грызуны имеют по 4 пальца на передних лапках и по 5 пальцев на задних.

2. Считается, что сирийского хомяка легко приучить отзываться на кличку.

3. Их зубы растут на протяжении всей жизни и не имеют корней.

4. Переднеазиатские хомяки отлично помнят других хомяков, с которыми когда-то жили в одной клетке.

5. У этих миниатюрных созданий очень плохое зрение, мир они видят в черно-белом цвете. А ориентироваться в пространстве им помогают отлично развитые слух и обоняние.


6. Беременность у самок данного вида длится 16-20 дней, при этом в помете могут появиться от 1 до 18 малышей. В среднем особь женского пола приносит потомство 2-4 раза в год.

Итоги

1. Сирийские хомяки — неприхотливые домашние питомцы.

2. Они отличаются дружелюбным нравом и редко проявляют агрессию.

3. Для комфортного содержания грызуну понадобится просторная клетка с необходимым оборудованием: домиком, кормушкой, поилкой, колесом, подстилкой (наполнителем).

4. Ежедневный рацион зверька должен быть сбалансированным. Важно сочетать готовый зерновой корм, растительную и белковую пищу.

Рекомендуем также

Хрумик.ру — «Мокрый хвост» — опасная болезнь

У вашего хомячка начался очень неприятно пахнущий понос с кровью? Не бросайте на самотек, диарея сама не проходит: понос у хомячка лечить нужно серьезно. Мало того, симптомы острой диареи могут означать, что зверек заболел одной из самый опасных болезней сирийских хомячков, которая называется «мокрый хвост».

Встречается эта болезнь очень часто, опасна тяжелыми осложнениями и заразностью. Хомяковод должен знать об этом и всегда быть настороже. К тому же даже ветеринары и те не все знают о правильном ее лечении, а уж хозяева и подавно.

К «мокрому хвосту» чувствительны молодые хомячки от 2 до 8 недель от роду, но заболеть могут и зверьки в любом возрасте. Каковы же симптомы и лечение заболевания?


Симптомы «мокрого хвоста»

Как узнать, что хомяк заболел? У заразившегося хомячка проходит неделя или две без симптомов (инкубационный период), и внезапно начинается сильный водянистый и вонючий понос, порой смешанный в кровью. Хомячок выглядит вялым и больным, мало пьет или вообще отказывается от всего. Мокрый хвост у хомяка соответствует названию болезни: задняя часть абсолютно мокрая, в отличие от обычного поноса, когда испачкана только область заднего прохода.

Отличие от любой другой связанной с диареей болезни хомяка: мокрый хвост опасен тем, что из-за сильного поноса у хомячка быстро происходит обезвоживание организма. Это можно заметить по коже: если приподнять кожную складку, то она не вернется сразу же в прежнее положение, как это бывает в нормальном состоянии, а останется стоять некоторое время. Без лечения именно из-за обезвоживания хомячок погибает в течение 1-3 дней. Процент смертности велик: 90%.

Если правильно и активно лечить хомячка, можно сохранить ему жизнь. Но даже если хомячок переживет инфекцию, могут возникнуть серьезные осложнения: воспаление слизистой, непроходимость тонкого кишечника, выпадение прямой кишки. Если же хомячок перенесет болезнь без осложнений, организм выработает антитела, благодаря которым появится пожизненный иммунитет к этому заболеванию.

Причины и диагностика «мокрого хвоста»

Болезнь «мокрый хвост» у хомяка провоцируют не только бактерии, но и стресс, отсутствие гигиены, изменение привычной для хомячка обстановки и присутствие других животных, в том числе хомячков, на его территории, скученность. Если хомячок перенес вирусное заболевание, недополучил полноценное питание, то его иммунитет ослаблен, и риск «мокрого хвоста» возрастает.

«Мокрый хвост» у хомяка: как лечить

Чтобы правильно лечить хомячка, важно как можно скорее обращаться к ветеринару. Чем раньше начнется лечение, тем больше шансов, что хомячок выживет. Лечение должно быть интенсивным, и важнейшие составляющие его – антибиотики и профилактика обезвоживания, а также строгая гигиена и карантин. Вот составные элементы лечения:

  • Антибиотики и антиобезвоживающие препараты. Из препаратов, которые эффективно борются с заболеванием, более всего предпочтительны байтрил и триметоприм. Для борьбы с обезвоживанием применяются лечебные растворы, давать их можно через рот, но лучше вводить при помощи подкожной инъекции лечебный раствор, кроме жидкости содержащий важные соли, которые организм теряет при поносе. И все-таки, несмотря на лечение, надо иметь в виду, что значительная часть хомячков болезнь не переживает. От любой другой болезни хомяка мокрый хвост отличается тем, что его трудно вылечить.
  • Пробиотики. Хомячку нужны также пробиотики — препараты, в которых находятся бактерии, составляющие часть нормальной флоры кишечника и помогающие ее восстановить (к примеру, актимель).
  • Гигиена. Клетки нужно мыть каждый день, чтобы предупредить повторное заражение. Необходим карантин – изоляция хомячков друг от друга в разные комнаты, уход за ними в перчатках, тщательное мытье рук. После гибели хомячка клетку важно тщательно дезинфицировать хлором и полтора-два месяца не использовать.

Профилактика опасной болезни «мокрый хвост» у хомяка – это не вода с разбавленным антибиотиком, которая, наоборот, снижает стойкость организма к заболеваниям. Профилактика — это хорошее, правильное питание, регулярное мытье клетки, правильное – одиночное – содержание хомячков.

Запаховые железы хомяков | Ветеринарная клиника

Прежде чем говорить о запаховых железах, следует разобраться с видами хомяков.

В домашних условиях наиболее часто содержат:

— сирийского хомяка;
— карликового хомячка Кемпбелла;
— карликового хомячка Джунгарского.
Последние два вида хомячков внешне очень похожи и даже скрещиваются между собой. Но, тем не менее, это разные хомячки.

Часто по поводу состояния сирийских хомяков задаются вопросы следующего характера:
— « … у хомяка недавно появились симметрично друг другу черные болячки на спине. Что это может быть? Насколько это опасно для животных и людей?»;
— «… заметила у хомяка по бокам спины два черных пятна, похожих на родимые пятна. Вокруг пятен большие круглые проплешины… »;
— «… что за черное пятно (пятнышки) на спинке (на бочку) у сирийского хомячка и как его лечить?»;
— «… наша хомячка стала чесаться по бокам, куда достают задние лапки, у нее даже корочки появились и справа и слева. Выглядит это как мелкие черные точки на некоторых частях тела… ».

Что в этом случае следует знать.
На боках у сирийских хомяков расположены запаховые железы, секрет которых используется хомяками для мечения территории. Железы располагаются симметрично по бокам, чуть впереди от задних лапок.
Это нормальное анатомическое образование для сирийских хомяков!

Какие имеются нюансы?
1. Внешний вид желез может отличаться у каждого конкретного сирийца. У кого-то они практически не заметны, у кого-то — ярко выражены. Железы могут быть крупными или мелкими, выпуклыми или плоскими, светлыми или коричневыми. Бывает, что железы выглядят просто как скопление темных точек на коже.
2. У самцов железы более заметны. Они крупные и темные, напоминают родинки или бородавки.
3. У самок железы не такие выпуклые и шершавые, как у самцов. Они малозаметны на теле и (если нет пигментации),могут не обнаруживаться вовсе.
4. Хомяк может (и должен) тереться боками (железами) о решетки клетки, когда метит территорию. Это не является поводом для беспокойства.
5. На железах шерсть не растёт.
6. У короткошерстых хомяков светлого окраса железы часто более заметны, чем у иных окрасов и с другим типом волоса.
7. У молодых самцов светлых окрасов на месте желез шерсть может быть другого, более яркого цвета, чем основной окрас.
8. Самцы могут «разлизывать железы», когда метят новую территорию, когда недалеко находится самка в течке, а так же в состоянии сильного стресса.
9. Железы не нужно «лечить». Однако важно учитывать, что изменение их внешнего вида или состояния волоса вокруг является признаком сильного стресса у хомяка (он старается как можно интенсивнее пахнуть, чтобы напугать врагов или закрепить за собой территорию).
9. Нередко отмечают случаи развития воспалительного или онкологического процесса на железах. Такие ситуации требуют консервативного или оперативного лечения у ветеринарного специалиста, занимающегося лечением грызунов.

По поводу карликовых хомяков так же часто задаются вопросы:

— «… у джунгарика на животе болячка, она опасна?»;
— «… мой джунгарик чешется и у него какой-то прыщик вскочил на животе. Скажите пожалуйста, что делать?»;
— «… у моего джунгарика (мальчик) что-то появилось прямо на середине живота похоже на сухую кожу, или на сухую болячку (что это может быть???».

Какова ситуация для «карликов».
У самцов карликовых хомячков (как джунгарских, так и хомячков Кэмпбелла) запаховая железа находится на животе. Это естественное анатомическое образование, волноваться из-за которого не нужно. Карликовые хомячки (как и сирийцы) метят территорию (выглядит это, как будто хомяк чешется или чешет живот). Железа обычно выглядит как пятно или «корочка» овальной формы, красного или коричневатого цвета, часто — с жёлтыми капельками секрета.

У самок железа отсутствует.

Таким образом, как у сирийских, так и карликовых хомяков в норме есть запаховые железы. Лечить данные анатомические образования не требуется. Однако важно отслеживать их внешний вид, так как он может отражать как эмоциональное состояние, так и здоровье хомяка. Кроме того, иногда запаховые железы воспаляются. У возрастных питомцев может появиться и опухоль запаховой железы. Данные состояния уже требуют ветеринарной помощи (терапии или хирургической операции).

Ветеринарный врач Казаков Артем Аркадьевич

Всё о золотистых хомячках | Блог ветклиники «Беланта»

Содержание статьи

Сирийский, или золотистый хомячок, родом из далёкой Сирии. Его впервые обнаружили в начале 1839 года, и найденные единичные экземпляры подтвердили, что это совершенно новый вид грызунов. Долгое время не было никаких данных об этом виде, пока в 1930 году профессор Ахарони не доставил трёх самок золотистого хомячка в свою лабораторию. Они прекрасно контактировали с другими обитателями: шиншиллами, песчанками и крысами. К тому же, золотистые хомячки оказались неприхотливы и показали высокую плодовитость. Именно эти качества позволили содержать данный вид грызунов в домашних условиях.

Характеристика золотистого хомячка

Длина сирийского хомячка составляет 8 см, у него короткий хвост, но весьма коренастое тело. Цвет меха – золотистый, жёлтый, рыжий и коричневый. Брюшко имеет более светлый цвет.

В лабораторных условиях получилось вывести несколько разновидностей данного грызуна. Хомяк дружелюбен и не кусается, если его брать в руки. Из-за активного поведения зверька необходимо быть аккуратным и внимательно открывать клетку, чтобы шустрый хомячок не успел выбежать на свободу. Если всё-таки грызун смог убежать, не нужно искать его по всей квартире, достаточно поставить клетку на пол и наполнить миску кормом. Через какое-то время хомяк сам вернётся и залезет в клетку.

Чтобы поладить с маленьким жильцом, следует проявить терпение. В первые разы, когда вы захотите взять хомяка в руки, отлавливать его лучше в темноте, чтобы не напугать. Через какое-то время хомячка можно смело оставлять на столе или другой поверхности для прогулки.

Условия содержания

Золотистые хомячки любят просторные клетки. Лучше всего взять металлическую, предназначенную для содержания кроликов. Некоторые предпочитают использовать в качестве клетки аквариумы, стеклянные ёмкости прямоугольной формы или террариумы.

Размер клетки для двух хомячков должен быть 50х40х40 см. Внутри обязательно должен стоять деревянный домик, чтобы грызуны могли там укрыться и отдохнуть. Кроме того, наличие домика благотворно влияет на выведение потомства. Золотистые хомяки сами обустраивают свой домик, перетаскивают туда солому, бумагу или лоскуты тряпок.

Температура воздуха, где находятся хомячки, не должна быть ниже 22 °С. Если температура опустится ниже, животное может впасть в спячку.

Рацион питания

В качестве корма для грызунов используют смеси с 20% содержанием жиров, углеводов, клетчатки и протеина. Суточная норма для взрослого грызуна – 50 гр, а именно:

  • зерновая смесь – 15 гр;
  • белый хлеб – 5 гр;
  • корнеплоды, свежие овощи – 30 гр.

Корма грызунов необходимо выбирать тщательно. Во-первых, смесь должна включать в себя питательные вещества, во-вторых, витамины и минералы. Так как золотистые грызуны крайне чувствительны к нехватке витаминов, их корм состоит из: овса, льна, кукурузы, проса. Что касается свежих овощей, то это – морковь и салат.

Давая свежие овощи хомяку, необходимо следить за их свежестью. Загнившие овощи вызывают сбои в пищеварительной системе, поэтому так важно следить за чистотой кормушки. Вода должна быть комнатной температуры и всегда чистой.

Интересно, что золотые хомячки больше предпочитают молоко, а не воду. Но это не значит, что в клетке должен быть только молочный напиток.

Размножение хомячков

Грызуны данного вида отлично приспособились размножаться в различных условиях содержания, будь то лаборатория, или квартира. За год одна пара приносит четыре помёта по шесть детёнышей в каждом. Температура в комнате для благоприятного размножения не должна быть ниже 25 °С.

Самок хомячка первый раз случают в возрасте двух месяцев. Способность к размножению у самки сохраняется весь год. Самцы же готовы к спариванию на 35 день существования.

Как именно происходит оплодотварение? Во-первых, наиболее удачное время для соединения двух золотистых грызунов – это вечер. Во-вторых, когда у самки начинается течка, её пересаживают к самцу и наблюдают за реакцией. Иногда, самка не подпускает к себе самца и даже начинает с ним драться. Если такое случается, то необходимо срочно разнять хомяков, иначе один из них может погибнуть или серьёзно пострадать.

При агрессивном поведении самки, её стоит изолировать на пару дней, а потом снова подсадить к самцу. Или выбрать более простой способ – попробовать пересадить её к новому партнёру. Если самка золотистого хомяка принимает ухаживания другого грызуна, происходит акт случки. Обычно за час получается всего 17-20 актов.

Примечательно, что самка остаётся с самцом до того момента как не забеременеет. После этого её лучше пересадить, поскольку она становится чрезмерно раздражительной и агрессивной. Беременную самку отсаживают в специально подготовленную клетку.

Беременность длится от 16 до 22 дней. В этот промежуток времени самка становится не такой активной, более осторожной и неповоротливой. Роды обычно начинаются в тёмное время суток. Первый помёт приносит пять детёнышей, а последующие — больше восьми штук. Лактационный период длится около месяца. За всю жизнь самка золотистого хомячка производит около 19 помётов.

Поскольку нагрузки при беременности и в период лактации высокие, то для самки хомячка нужно пересмотреть нормы питания. Добавить больше витаминов, молока, овощей. При недостатке витаминов и минералов, самки легко становятся каннибалами и съедают своих детёнышей. Если это случилось, то такие самки никогда не смогут нормально выращивать потомство.

Молодые новорождённые грызуны активно развиваются. Через 24 часа у хомячков на коже появляются пигментные пятна, но вскоре всё их тело покрывается тонким коричневато-золотистым пушком. На 12 -13 день от рождения, молодые особи выползают из гнезда, но их глаза еще не открыты. Только на 15-16 день слепые хомячки начинают видеть.

На 10 день детёныши могут попробовать крошку хлеба или другую пищу, если она случайно попала в гнездо или самка специально не принесла её для своего потомства.

В период вскармливания не рекомендуется брать детёнышей в руки и чистить гнездо. Самка не любит когда её беспокоят, и в порыве агрессии может уничтожить всё своё потомство. Молодых золотистых хомячков пересаживают в 3-х недельном возрасте.

В содержании золотистых хомячков нет ничего сложного. Главное соблюдать правильный рацион питания, ухаживать за зверьком, и обязательно выпускать на прогулку. Некоторые хозяева предпочитают выпускать грызунов в комнате, тем самым давая полную свободу маленькому жильцу. Такие прогулки благотворно влияют на грызуна, но могут быть весьма опасны. Поскольку ручные хомячки очень любят тёмные места, и если они их находят — достаточно тяжело потом их оттуда доставать.

Перед тем, как заводить маленького четвероногого друга, обязательно прочитайте о методах его содержания и способах ухода. И только после этого решите, сможете ли вы ухаживать за зверьком и обеспечить ему отличные условия для жизни в клетке.

Интересные темы

Почему хомяк постоянно чешется.

Что делать, если хомяк чешется
Содержание
  1. Причины зуда у хомяков
  2. Лечение

Небольшие почесывания абсолютно нормальны для хомячков, но если он постоянно чешется и имеет другие симптомы, такие как шелушение кожи, выпадение волос, чихание и выделения из глаз, то это уже не нормально. Зуд у хомячков может быть вследствие множества различных причин. Если есть вышеперечисленные симптомы необходимо посетить ветеринара-врача, а лучше узкопрофильного специалиста врача-ратолога. Врач должен определить причину, вызвавшую зуд и назначить соответствующее лечение.

Наиболее распространенные причины зуда у хомячков это эктопаразиты. Зуд у хомячков может быть при аллергии, неправильном кормлении, кожных абсцессах и грибковых болезнях.

Вши и власоеды у них не встречаются, блохи могут передаваться хомячкам от других домашних животных. Наиболее часто у хомячков встречаются клещи.

Notoedres cati и Notoedres muris обычно вызывают сильный зуд, образование корок на теле. Является заразным заболеванием, так же может передаваться грызунам других видов и кошка. Эти не могут постоянно обитать на человеке, но кратковременно находится, и вызывать зуд у человека могут.

Sarcoptes scabiei вызывает также сильный зуд как и при нотоэдрозе, но обычно протекает тяжелее. Клещ так же паразитирует на собаках, кошках и людях.
Паразитирование Demodex criceti и Demodex aurati проявляется выпадением волоса, шелушением кожи. При демодекозе обычно не бывает зуда, присоединение вторичной бактериальной микрофлоры, может сопровождаться зудом.

Если хомячок постоянно чешется, чихает, у него есть проблемы с дыханием и выделения из глаз, то это может быть аллергия. Многие факторы могут приводить к аллергической реакции, в том числе моющие средства, средства для полировки мебели, духи, корм. Кедровые опилки, используемые как подстилка для хомячка, могут вызывать аллергические реакции.

Иногда неадекватное или недостаточное питание может вызвать у хомячка зуд. Особенно это относится к подсолнечным и другим видам семян, они не должны основным питанием животного. Лучше кормить специальными кормами для хомячков, можно добавлять яблоки, морковь, горох, различные крупы.

Кожные абсцессы могут вызывать сильное беспокойство и постоянное расчесывание.

Грибковые заболевания редко бывают у хомячков и редко проявляются зудом. Возбудитель дерматофитии у хомячков Trichophyton mentagrophytes. Этот грибок опасен для людей, собак и кошек.

Статья подготовлена врачами отделения экзотических животных «МЕДВЕТ»
© 2015 СВЦ «МЕДВЕТ»

болезни, симптомы и лечение, делают ли прививки домашним грызунам

Чем чаще всего болеют грызуны

Любое заболевание мелкого грызуна сопровождается ухудшением его внешнего вида и снижением активности. Здоровые особи ведут подвижный образ жизни, проявляют интерес ко всему, что их окружает, и демонстрируют хороший аппетит. Шерстные покровы выглядят ухоженными, дыхание спокойное, а глазные яблоки чистые.

При обнаружении каких-либо отклонений от нормального состояния необходимо проверить питомца в ветеринарной клинике.

Причины

Есть несколько факторов, провоцирующих проблемы со здоровьем хомяка:

  1. Некачественная пища и вода.
  2. Воздействие сквозняков и холода.
  3. Переизбыток влаги в клетке.
  4. Отсутствие укромного места для сна и отдыха питомца.
  5. Резкие скачки температуры.

Общие симптомы и признаки недугов

Понять, что питомец заболел, можно по таким признакам:

  1. Снижению подвижности.
  2. Отказу от употребления пищи.
  3. Быстрой потере веса.
  4. Чиханию и сопению.
  5. Интенсивным выделениям из глаз и носа.
  6. Намоканию шерстных покровов вокруг хвоста.
  7. Потере шерсти.


Больной питомец быстро теряет вес, чихает и сопит.
При обнаружении подобной симптоматики следует проконсультироваться с ветеринарным специалистом. Важно обследовать питомца как можно быстрее, поскольку он может погибнуть.

Достаточно часто хомяков поражают респираторные инфекции, в результате которых у них развивается тяжелая пневмония. На ранних стадиях грызун прячется в клетке, чихает и страдает от выделений из глаз и носа. Если не провести лечение, ему станет тяжело дышать с открытым ртом. Затяжное воспаление легких приведет к гибели зверька.

Распространенным признаком болезней является недостаточный вес хомяка, поэтому рекомендуется регулярно взвешивать его.

Взрослые особи сирийской породы обладают весом 90 г, а джунгарской – от 30 г.

Прочие болезни хомяков

Опухоль у хомяка

Опухоль у хомяка — заболевание вызванное путем появления в организма новообразования в виде злокачественной опухоли.

  • причины — генетическая предрасположенность. Некоторые продукты могут положительно влиять на развитие рака у хомяков. Склонность так же имеют пожилые особи;
  • симптомы — признаки зависят от расположения опухоли, ими могут быть разные органы, а симптомами рвота, диарея, нарушение движений, перебои в работе организма в общем и т. д.;
  • лечение — предполагает удаление злокачественного новообразования, но только в том случае, если это необходимо.

Заболевания сердца хомяка

У хомяка заболевания сердца — характеризуются перебоями в работе этого органа. У хомяков встречаются довольно редко.

  • причины — наличие сильного стресса или высокая температура воздуха, которая влияет на регулирование работы сердечной мышцы;
  • симптомы — одышка, высокий пульс, апатия и снижение активности;
  • лечение -на первых этапах лечения рекомендуют изменить условия содержания хомяка. Если это не помогает, а состояние только ухудшается, нужно ввести инъекцию эффортила. Опять же все лечение назначается строго индивидуально. Самолечение должно быть исключено.

Простуда также относится к болезни хомяка

  • причины — может стать переохлаждение организма или действие вируса;
  • симптомы — общая слабость, чиханье, выделения из носа, выделения из глаз;
  • лечение — рекомендуют давать питомцам фрукты, которые насыщены жидкостью, что бы не допустить обезвоживание организма. Если запустить простудные заболевания, они могут перерасти в более серьезные.

Обзор распространенных болезней у домашних хомяков

Заболевания грызунов бывают заразными и незаразными.

К первой группе относятся:

  1. Бактериальные инфекции. Провоцируют развитие кожных, желудочно-кишечных и других воспалений.
  2. Вирусные. Воздействуют на слизистые оболочки и глаза, а еще способствуют появлению опухолей.
  3. Грибковые. Сопровождаются кожными заболеваниями.


Бактериальные инфекции провоцируют развитие воспалений.
Отдельные болезни передаются людям, поэтому следует соблюдать меры предосторожности при уходе за животным и постараться как можно быстрее доставить его в ветеринарную клинику. Только после выполнения ряда анализов специалист сможет поставить точный диагноз и спрогнозировать дальнейшее развитие событий. Многие заболевания приводят к летальному исходу, но хозяину нужно сделать все возможное, чтобы питомец выздоровел.

В список незаразных патологий входят:

  1. Ушибы, прокусы и травмы в результате падения хомяка с высоты или драки с другими животными.
  2. нарушение обменных процессов в организме, в т. ч. сахарный диабет, который часто возникает у представителей джунгарской породы.
  3. Болезни на фоне стрессовых ситуаций. Сердечные заболевания, инфаркты и инсульты.

Болезни хомяков — ротовая полость и кожные покровы

Нарывы. Болезни хомяков

Нарывы у хомяков — это своего рода ссадины, которые появляются у хомяков в основном на подушечках лап.

  • причины — точные причину появления нарывов не обнаружены, но ветеринарные врачи склоняются к механическим травмам;
  • симптомы — наличие на лапах питомца ссадин, которые обнаруживаются при визуальном осмотре хомяка;
  • лечение — чаще всего, что бы устранить нарывы у хомяков, врачи назначают применение мазей с цинком или рыбьем жиром, или препаратов на основе этих составляющих. Лечение такого, на первый взгляд незначительно заболевания может занять несколько месяцев, так как подушечки очень чувствительны и постоянно подвергаются нагрузке.

Аномалии зубов. Болезни хомяков

Аномалии зубов у хомяков — все представители грызунов имеют такую особенность, как постоянный рост передних зубов. Из-за этого у животного может нарушаться прикус и зубы просто не смыкаются. Из этого уже вытекают нарушения пищеварения и т.д.

  • причины — причиной таких аномалий могут быть генетические особенности, которые предполагают ускоренный рост зубов, так же причиной может быть рацион питания в котором содержится очень мало твердых кормов. Животное просто не успевает стачивать свои зубы;
  • болезни хомяков часто распространяются на зубы, самые распространенные симптомы зубных патологий это усиленное слюноотделение. Питомец может отказаться от пищи, перестать грызть еду;
  • лечение — что бы вылечить этот вид патологии, не стоит заниматься самолечением, а обратиться за помощью к ветеринару. Часто проделывается такая процедура, как обработка зубов бормашиной. Если в результате недуга появились «крючки» на зубах, их стоит так же удалить.

Бактериальные и вирусные

Домашние грызуны уязвимы к бактериальным и вирусным инфекциям. Они могут заразиться от контакта с другими больными животными, заболеть от употребления несвежей пищи или нахождения в грязной клетке. Отдельные заболевания передаются от людей к питомцам, и наоборот.

Колибациллез

Является опасным инфекционным заболеванием, которое развивается на фоне повышенной концентрации кишечной палочки в органах пищеварения. Болезнь заразная, поэтому если в клетке находится несколько хомяков, потребуется проверить каждую особь.


Колибациллез — инфекционное заболевание.

Второе название колибациллеза – «мокрый хвост», поскольку ключевым признаком развития патологии является сильная диарея. На ранних стадиях наблюдается снижение аппетита, стремительная потеря веса, вялое и беспокойное поведение, наличие влажности на шерстных покровах.

При усугублении симптоматики кал питомца становится похожим на мочу. После обнаружения перечисленных признаков нужно обратиться к ветеринару за помощью и консультацией по лечению колибациллеза. В большинстве случаев животному назначают препараты тетрациклиновой группы, которые добавляют в пищу или воду. Изредка применяются уколы Хлорамфеникола.

Излечение хомяка возможно только на начальных стадиях развития болезни.

С целью профилактики следует держать питомцев в раздельных клетках и проводить частую уборку.

Диплококкоз

Является инфекцией дыхательных путей, которую провоцируют круглые бактерии – диплококки. Общая симптоматика проявляется в виде слабости и вялости. Питомец начинает дрожать, а из носа у него появляются выделения. В некоторых случаях хомяк полностью отказывается от пищи.

Для лечения инфекции применяется специальная сыворотка. Важно ввести ее как можно раньше, поскольку диплококкоз может погубить зверька за 2-3 дня.

Сальмонеллез

Сопровождается вялым и апатичным состоянием питомца. Также животное отказывается от приема пищи и теряет аппетит. Лечение неэффективно.


Сальмонеллез сопровождается вялым состоянием.

Вирусная пневмония

Болезнь развивается на фоне ослабления иммунной системы и повышенной активности пневмококков. В большинстве случаев этому способствуют сильные переохлаждения или дефицит витаминов в организме.

Характерная симптоматика:

  1. Снижение активности, вялое поведение животного.
  2. Отсутствие аппетита.
  3. Кашель и хриплое дыхание.
  4. Слизистые выделения.

После прохождения курса лечения витаминами и антибиотиками питомец становится полностью здоровым.

Болезнь Ауески

Поражает нервную систему и приводит к повышенной беспокойности питомца. Хомяк начинает дергаться, постоянно чешется и перестает проявлять интерес к пище. Для быстрого выздоровления ему дают специальную сыворотку. Без должного лечения случается паралич и смерть особи.


Болезнь Ауески поражает нервную систему.

Лимфоцитарный хориоменингит

Передается от зараженных самок детенышам и проявляется в виде общей слабости организма и стремительной потери веса. На ранних стадиях хориоменингит поддается лечению. Важно приступить к борьбе с заболеванием как можно раньше, поскольку болезнь может передаваться от животных людям.

Туберкулез

Заболевание развивается в результате размножения в кишечнике или дыхательных путях туберкулезных палочек. Существует 2 формы заболевания – легочная и кишечная. Заразиться животное может воздушно-капельным путем или через пищу.


Туберкулез развивается в результате размножения палочек.

Болезнь сопровождается одышкой, снижением аппетита и полным истощением организма. При легочной форме наблюдается сильный кашель, а при кишечной – понос. При усугублении симптоматики у зверька мутнеют глаза. Поскольку туберкулез неизлечим, лучше усыпить питомца.

Эндометрит

Болезнь поражает самок, проявляется в воспалении матки и придатков на фоне повышенной активности стрептококков.

Заболевание случается при частых родах и половых контактах. Чтобы спасти питомца, необходимо отвезти его на операцию.

Листериоз

Является инфекционным заболеванием, широко распространенным среди грызунов.

Есть несколько форм листериоза:

  1. Острая.
  2. Подострая.
  3. Хроническая скрытая.


Листериоз широко распространен среди грызунов.
Питомцы могут заразиться через употребление инфицированной пищи или при контакте с другими больными особями.

Чума

О наличии заболевания свидетельствуют истощение организма, апатичное и вялое поведение, приступы судорог и появление синюшности на слизистых оболочках. Эффективные методы лечения отсутствуют, поэтому хомяка лучше усыпить.

Паралич

Развитие заболевания сопровождается вялым и апатичным состоянием, снижением аппетита и полным отказом от пищи, потерей координации движений и недержанием мочи. Через несколько дней после поражения питомец погибает.


Паралич сопровождается потерей координации движений.

Оспа мышиных

При хронической форме питомец ощущает острую боль, его лапки отекают. Изначально на пораженных участках появляются жидкие, водянистые выделения, которые вскоре подсыхают, образуя корочки. Излечить больного хомяка практически невозможно.

Паразитарные, грибковые, дерматологические

Независимо от породных особенностей хомяки подвержены грибковым и паразитарным заболеваниям. У джунгариков часто диагностируют лишай, трихомоноз и дерматофитоз. Нередко зверьков атакуют глисты. В результате развития таких болезней питомцы ощущают сильный зуд, беспокойство и ухудшение шерстных покровов. На теле образуются расчесы, ранки и сыпь.


Хомяки подвержены паразитарным заболеваниям.

При дерматофитозе кожные покровы приобретают желтоватый оттенок и начинают шелушиться. При отсутствии эффективного лечения в места поражений проникают патогенные микроорганизмы, провоцирующие развитие воспалений в структурах дермы.

Кроме того, хомяки уязвимы к дерматитам, дерматозом и аллергическим реакциям. При дефиците витаминов и минералов состояние шерстного покрова ухудшается, а защитные функции иммунитета снижаются.

Болезни глаз

Из-за физиологических особенностей представители сирийской и джунгарской пород и некоторые другие виды подвергаются офтальмологическим патологиям. Среди самых распространенных заболеваний – конъюнктивит серозной, гнойной или аллергической этиологии. Кроме того, зверьки уязвимы к катаракте, увеиту и глаукоме.


Некоторые хомяки имеют офтальмологические патологии.

Определить развитие болезней глаз можно по таким признакам:

  1. Припухлости.
  2. Покраснению белков.
  3. Повышенной слезоточивости.
  4. Наличию слизистых или гнойных выделений.
  5. Слипанию век.

При обнаружении перечисленных признаков следует показать питомца специалисту для выявления возбудителя и подбора лечения. Без должной терапии возникает риск развития гнойных процессов и ухудшения зрения.

Конъюнктивит

Заболевание проявляется в тяжести и склеивании век у питомца. В большинстве случаев его провоцирует простуда, но иногда болезнь имеет бактериальную природу. С целью терапии глаза хомяка промывают подсоленной водой или обрабатывают специальными каплями, назначенными специалистом.

Незаразные болезни

Появление незаразных болезней главным образом связано с неправильными условиями содержания. Это может быть что угодно – слишком высокая или слишком низкая температура, неправильное кормление в неправильных дозах. Также хомяк может получить травмы из-за драки с соседом и травмоопасных условий (сетчатый пол, возможность упасть с большой высоты).

Расстройство пищеварения

Проявляется в изменении кала. Основной симптом — кал на шерсти вокруг ануса. В том случае, если владелец хомяка уверен, что проблемы со стулом напрямую исходят из неправильного рациона, можно начать лечение без похода к ветеринару. Чтобы хомяк пошел на поправку, нужно назначить зверьку строгую диету и поить рисовым отваром через специальный инсулиновый шприц. Также в лечении пригодится отвар ромашки. Если у питомца диарея – пригодится отвар из дубовой коры. Если на конец вторых суток питомцу не становится лучше, то скорее всего в диагнозе вы ошиблись. Пора нести хому к ветеринару.

Конъюнктивит

Одна из самых распространенных болезней среди грызунов. Из-за особенностей вида – выпуклых глаз, редкий хомяк за свою жизнь не заболевает конъюнктивитом.


Вот так выглядит конъюнктивит у хомячка. Жалко бедолагу. Надеюсь, хозяин сможет ему помочь

Случаи бывают настолько запущенные, что гной полностью закрывает глазные яблоки. Чтобы не допустить такого развития событий, хозяевам нужно время от времени промывать глаза хомячку раствором фурацилина, дополняя флоксалом. Конъюнктивит обычно не требует похода к ветеринару и не несет угрозы для жизни сирийца. Но если вы лишний раз проконсультируетесь — хуже точно не будет.

Травмы

Сирийцы совершенно не боятся высоты. Они привыкли лазить где угодно еще с тех времен, когда их предки обитали в дикой природе. Их естественная среда обитания – равнины, где надо очень сильно постараться, чтобы получить травму при падении с высоты. Также хомяки могут конфликтовать друг с другом, нанося друг другу тяжелые увечья. Владельцу любой породы хомячков, не только сирийцев, рекомендуется всегда держать в квартире средства для обработки ран и антисептик. Очень хорошо на эту роль подойдет хлоргексидин.

Учитывая размер зубов и кусачесть отдельных представителей хомячьей породы, антисептик может понадобиться и хозяину. Пусть лучше он будет, но не пригодится, чем бегать и искать его в неподходящий момент.

Эндокринные патологии, болезни ЖКТ, нарушение обмена веществ

Помимо вирусных, простудных и грибковых заболеваний, у хомяков случаются проблемы с обменом веществ, нарушения в работе эндокринной системы и органах желудочно-кишечного тракта. В большинстве случаев патологии носят наследственный характер, но порой случаются из-за неправильного ухода.

Ожирение

В диких условиях грызуны проводят большую часть времени в движении. В клетке они ограничены в активности и начинают стремительно набирать вес. Ожирение – первый путь к развитию сердечно-сосудистых патологий и атрофии мышц. Для исключения подобных неприятностей важно следить за режимом питания и обеспечить питомцу комфортные условия для физической активности. Для этого следует установить в клетке беговое колесо, тоннели, лесенки и прочие аксессуары. Необходимо периодически выпускать хомяка на свободный выгул и следить, чтобы он не поранился.


Ожирение хомяков провоцирует развитие сердечно-сосудистых патологий.

Зрелые особи подвергаются ожирению и мочекаменной болезни чаще, чем молодые. У активных представителей джунгарской породы проблема встречается редко. Сирийские хомяки более склонны к ожирению.

Кишечная палочка

Инфекционная болезнь доставляет сильный дискомфорт животным и может привести к их гибели. При прогрессировании заболевания у грызуна меняется флора кишечника.

Кишечная палочка появляется в результате проникновения патогенных микроорганизмов и сопровождается высокой температурой тела и кровяным поносом.

Энтерит

Болезнь затрагивает органы пищеварительного такта, провоцируя вздутие живота и диарею. К предрасполагающим факторам относится отсутствие в рационе питомца сена. Для борьбы с энтеритом ставят клизму, вводя кал здорового животного.


Энтерит затрагивает органы пищеварительного такта.

Отравление

Хомяк подвергается пищевым отравлениям в результате низкого качества пищи и наличия грязи или бытовой химии на продуктах питания. Симптоматика: ухудшение аппетита, летаргия, рвота и понос.

Курс терапии назначает специалист, руководствуясь результатами диагностики. При этом необходимо правильно отличить отравление от вирусной инфекции.

Сахарный диабет

Хомяки подвергаются заболеванию при избыточном потреблении углеводов. Кроме того, этому способствует генетическая предрасположенность. Обнаружить развитие сахарного диабета можно по запаху ацетона, который исход от мочи и слюны питомца. Нужно сдать кровь на анализ. Постановкой окончательного диагноза должен заниматься специалист. С целью профилактики сахарного диабета необходимо пересмотреть режим питания и исключить сахар из рациона животного. Также следует сделать все прививки.


Сахарный диабет возникает при избытке углеводов.

Инсульт

Развивается на фоне нарушения обменных процессов и возрастных изменений в организме питомца. При неправильном кормлении на стенках сосудов грызуна накапливаются холестериновые бляшки, провоцирующие затруднение кровотока. Через какое-то время бляшки полностью закупоривают сосуд, из-за чего он лопается.

Если хомяк странно себя ведет, еле ходит и трясется, вскоре он может погибнуть.

Каменная болезнь

Проблема возникает в результате нарушения солевого метаболизма, из-за чего в мочевом пузыре, почках и желчных протоках накапливается песок. Вскоре он преобразуется в камни, которые начинают двигаться и вызывают невыносимую боль у животного. Кроме того, при таком заболевании у грызуна поджимается хвост, а в моче появляется кровь. У представителей мелких пород каменная болезнь неизлечима.


Каменная болезнь появляется из-за нарушения метаболизма.

Мочеполовая система

Нарушения в мочеполовой системе сопровождаются потерей аппетита, проблемами с опорожнением и вялым поведением хомяка. Если обнаружить симптомы на ранних стадиях и приступить к терапии, более опасных последствий можно избежать.

Цистит

При прогрессировании заболевания у питомца начинает болеть нижняя часть живота, появляется жжение при мочеиспускании. В результате потери большого количества жидкости грызун всегда хочет пить. В большинстве случаев цистит развивается на фоне переохлаждения организма, которое возможно даже из-за работающего вентилятора.


При цистите у хомяка болит живот.

Для лечения болезни используют антибиотики. Главное – поставить точный диагноз, поскольку цистит часто сравнивают с колибациллезом из-за характерного признака – мокрой шерсти.

Для профилактики не нужно допускать переохлаждения хомяка, поэтому его клетку лучше держать подальше от распахнутых окон.

Поликистоз яичников

Является гормональным нарушением, которое развивается при частых половых контактах или родах. Грызун становится раздражительным и вялым, а в области живота у него появляется припухлость. Частота испражнений сокращается. Для излечения самки потребуется прибегнуть к хирургическому вмешательству.

Хомяк заболел. Как понять и что делать

Хозяин не может спокойно смотреть, когда хомяк заболел.

К этим маленьким зверькам очень быстро привыкаешь.Любой владелец заметит, если хомяк заболеет. Его поведение очень меняется, но те, кто недавно приобрели маленького грызуна, наверняка задаются вопросом,
как понять, что хомяк заболел?
Хомяки подвержены многим заболеваниям. Это могут быть кожные заболевания, сердечно-сосудистые, инфекционные, желудочные и многие другие. Когда хомяк заболел, признаки

видны невооруженным взглядом. Питомец становится вялый, сонный, много лежит. Иногда если
хомяк заболел, он не открывает глаза
и лежит в углу клетки. Так же частым симптомом болезни является чихание, насморк, кашель и расстройство стула.

При кожных заболеваниях симптомами являются залысины на коже, обильное выпадение шерсти, перхоть, ранки, шелушение. При этом хомяк практически не хочет кушать. Такое может происходить из-за паразитов или из-за лишая. Лишай может передаться только от другого зараженного животного.

Другие заболевания у хомяков

У грызунов существуют и другие проблемы со здоровьем. Для борьбы с ними необходимо проконсультироваться с ветеринаром и выполнить диагностику.

Вызванные стрессами

Хомяки достаточно уязвимы к стрессовым ситуациям. Они боятся громких звуков, страдают из-за скудного питания, неблагоприятных условий содержания или повышенного внимания со стороны других питомцев, например кошек. В результате у них могут развиваться экзема, облысение, паралич и инфаркт.


Хомяки уязвимы к стрессу, боятся громких звуков.

Чтобы избежать подобного сценария, нельзя кричать на грызуна или подпускать к клетке других домашних любимцев. Кроме того, следует подбирать правильный рацион и держать клетку в местах, где отсутствуют сквозняки.

Сердечные

При проблемах с сердечно-сосудистой системой у хомяка наблюдаются одышка, учащение пульса и снижение активности. На ранних стадиях болезни питомцев лечат путем изменения условий содержания либо инъекцией Эффортила.

Простуда

Причины заболевания – переохлаждение или вирусная инфекция. Проявляется простуда такими симптомами, как общая слабость, интенсивные выделения из носа и глаз.


При простуде появляется слабость.

Нарывы

Если вы заметили черное пятно или ссадины на подушечках конечностей, на спине или в области живота, необходимо обработать их мазями на основе цинка или рыбьим жиром. Лечение ссадин может занять несколько месяцев.

Воспаление «мешочков»

Защечные мешки часто повреждаются при контакте с острым предметом. Если в них начнет попадать пища, это усугубит состояние питомца. Чтобы предотвратить осложнения, потребуется показать грызуна ветеринару для обследования и очистки ран бактерицидными препаратами.

Герпес

Болезнь передается от одних особей к другим. В большинстве случаев герпес не имеет выраженной симптоматики и проходит за 6-9 суток.

Прочие болезни хомяков

Опухоль у хомяка

Опухоль у хомяка – заболевание вызванное путем появления в организма новообразования в виде злокачественной опухоли.

  • причины – генетическая предрасположенность. Некоторые продукты могут положительно влиять на развитие рака у хомяков. Склонность так же имеют пожилые особи;
  • симптомы – признаки зависят от расположения опухоли, ими могут быть разные органы, а симптомами рвота, диарея, нарушение движений, перебои в работе организма в общем и т.д.;
  • лечение – предполагает удаление злокачественного новообразования, но только в том случае, если это необходимо.

Заболевания сердца хомяка

У хомяка заболевания сердца – характеризуются перебоями в работе этого органа. У хомяков встречаются довольно редко.

  • причины – наличие сильного стресса или высокая температура воздуха, которая влияет на регулирование работы сердечной мышцы;
  • симптомы – одышка, высокий пульс, апатия и снижение активности;
  • лечение -на первых этапах лечения рекомендуют изменить условия содержания хомяка. Если это не помогает, а состояние только ухудшается, нужно ввести инъекцию эффортила. Опять же все лечение назначается строго индивидуально. Самолечение должно быть исключено.

Простуда также относится к болезни хомяка

  • причины – может стать переохлаждение организма или действие вируса;
  • симптомы – общая слабость, чиханье, выделения из носа, выделения из глаз;
  • лечение – рекомендуют давать питомцам фрукты, которые насыщены жидкостью, что бы не допустить обезвоживание организма. Если запустить простудные заболевания, они могут перерасти в более серьезные.

Препараты, которыми лечат грызунов

Отдельные лекарства опасны для организма хомяков, поэтому от их использования лучше отказаться. Среди них – Пенициллин, Ампициллин, Гентамицин и цефалоспорины. Запрещено использовать антибиотики без консультации с ветеринаром.

Для укрепления организма питомцам дают витаминные таблетки и жидкие концентраты.

Грибковые поражения лечат такими препаратами:

  1. Тридермом.
  2. Флуконазолом.
  3. Кетоконазолом.
  4. Гризеофульвином.

Мощное нейтрализующее SARS-CoV-2 нанотело демонстрирует терапевтическую эффективность в модели COVID-19 сирийского золотого хомяка

Иммунизация и создание библиотеки VHH

Домен, связывающий рецептор SARS-CoV-2 (аминокислоты 330-532) , рецептор-связывающий домен SARS-CoV-2, слитый с Fc hIgG1 (RBD-Fc) и тримерным шиповидным белком (аминокислоты 1–1208), получали, как описано Huo et al. 25 . Антитела были выращены у ламы путем внутримышечной иммунизации 200 мкг рекомбинантного RBD и 200 мкг RBD-Fc в день 0, а затем 200 мкг RBD и 200 мкг белка S в день 28.В качестве адъюванта использовали Gerbu LQ#3000. Кровь (150 мл) собирали на 38-й день. Иммунизацию и обращение с ламой проводили в соответствии с лицензией на проект PA1FB163A. Мононуклеарные клетки периферической крови готовили с использованием Ficoll-Paque PLUS в соответствии с протоколом производителя; тотальную РНК экстрагировали с использованием TRIzol™; обратную транскрипцию и ПЦР проводили с помощью обратной транскриптазы SuperScript IV с использованием праймера CALL_GSP. Пул последовательностей, кодирующих VHH, амплифицировали двумя раундами ПЦР с использованием CALL_001 и CALL_02 (раунд 1), VHH_For и VHH_Rev_IgG2 плюс VHH_Rev_IgG3 (раунд 2).После очистки с помощью электрофореза в агарозном геле кДНК VHH клонировали в сайты SfiI фагемидного вектора pADL-23c. В этом векторе последовательности, кодирующей VHH, предшествует лидерная последовательность pelB, за которой следуют линкер, His6 и метка cMyc (GPGGQHHHHHHGAEQKLISEEDLS). Электрокомпетентные клетки E. coli TG1 трансформировали рекомбинантным вектором pADL-23c, в результате чего была получена библиотека VHH из ~4 × 10 9 независимых трансформантов. Затем полученный запас библиотеки TG1 инфицировали хелперным фагом M13K07 для получения библиотеки фагов, представляющих VHH.

Выделение VHH

Фаги, демонстрирующие VHH, специфичные для RBD SARS-CoV-2, были обогащены после двух раундов биопэннинга на 50 нМ и 2 нМ биотинилированного RBD соответственно путем захвата с помощью Dynabeads™ M-280 (Thermo Фишер Сайентифик). Обогащение после каждого раунда пэннинга определяли путем посева клеточной культуры с 10-кратными серийными разведениями. После второго раунда пэннинга было отобрано 93 отдельных фагемидных клона, фаги, отображающие VHH, были выделены путем инфицирования хелперным фагом M13K07 и протестированы на связывание с RBD с помощью комбинации ELISA с конкуренцией и ингибированием.В этих анализах RBD иммобилизовали на 96-луночном планшете и связывание фаговых клонов измеряли в присутствии избытка растворимого RBD (ELISA для ингибирования) или связывания RBD h21-h5-Fc 25 (конкурентный ELISA). Связанный фаг обнаруживали с помощью HRP-связанного антитела против М13 (1:5000; Cytiva 27-9421-01).

Связывающие фаги ранжировали в соответствии с анализом ингибирования, а затем классифицировали либо как конкурирующие с h21-h5 (т. е. имеющие один и тот же эпитоп), либо как неконкурентные (т. е. связывающиеся с другим эпитопом на RBD).Клоны секвенировали и группировали в соответствии с идентичностью последовательности CDR3.

Конструирование трехвалентных VHH

Для получения тримерных VHH фрагменты генов C1, C5, h4 и F2 использовали в качестве матриц для амплификации трех фрагментов методом ПЦР со следующими парами праймеров: TriNb_Neo_F1 и TriNb_R1; TriNb_F2 и TriNb_R2; TriNb_F3 и TriNb_Neo_R1; три фрагмента затем соединяли вместе с помощью реакции ПЦР с использованием праймеров TriNb_Neo_F2 и TriNb_Neo_R2. Затем продукт тримерного гена встраивали в вектор pOPINTTGneo путем клонирования Infusion®.pOPINTTG содержит лидерную последовательность мю-фосфатазы и С-концевую метку His6 51 .

Конструирование вариантов рецептор-связывающего домена

Для создания Alpha RBD с использованием RBD-WT в качестве матрицы ген сначала амплифицировали в виде двух фрагментов с парами праймеров (1) TTGneo_RBD_F и N501Y_R и (2) TTGneo_RBD_R и N501Y_F ; два фрагмента затем соединяли вместе с помощью реакции ПЦР с использованием праймеров TTGneo_RBD_F и TTGneo_RBD_R. Продукт гена Alpha RBD затем клонировали в вектор pOPINTTGneo с помощью клонирования Infusion®.

Ген Beta RBD был создан с использованием Alpha RBD в качестве матрицы в два этапа. Сначала два фрагмента амплифицировали с парами праймеров (1) TTGneo_RBD_F и E484K_R и (2) TTGneo_RBD_R и E484K_F. Два фрагмента затем соединяли вместе с помощью реакции ПЦР с использованием праймеров TTGneo_RBD_F и TTGneo_RBD_R и клонировали в вектор pOPINTTGneo с помощью клонирования Infusion®. Во-вторых, используя эту плазмиду в качестве матрицы, два фрагмента амплифицировали с парами праймеров (1) TTGneo_RBD_F и K417V_R и (2) TTGneo_RBD_R и K417V_F.Фрагменты затем объединяли с помощью реакции ПЦР с использованием праймеров TTGneo_RBD_F и TTGneo_RBD_R, а затем полученный генный продукт клонировали в вектор pOPINTTGneo с помощью клонирования Infusion® для получения вектора экспрессии Beta-RBD.

Для создания версий RBD, слитых с Fc huIgG1, гены RBD из вектора pOPINTTGneo амплифицировали с помощью пары праймеров TTGneo_RBD_F и RBD_Fc_R с последующим клонированием в вектор pOPINTTGneo-Fc путем клонирования Infusion®. pOPINTTGneo-Fc содержит лидерную последовательность мю-фосфатазы, Fc huIgG1 и С-концевую метку His6 51 .

Производство белка

Обычно моновалентные VHH клонировали в вектор pOPINO 52 , содержащий лидерную последовательность OmpA и С-концевую метку His6. Конструкции C5 и h4 VHH, используемые для кристаллизации комплексов C5-Kent RBD и h4-Kent RBD, соответственно, были созданы путем амплификации с парой праймеров PelB_F и PelB_R с последующим клонированием в фагемидный вектор pADL-23c путем инфузии. ® клонирование. pADL-23c содержит лидерную последовательность PelB и С-концевую метку His6.Плазмиды трансформировали в штамм WK6 E. coli , и экспрессию белка индуцировали 1 мМ IPTG, выращивая в течение ночи при 20°C. Периплазматические экстракты готовили с помощью осмотического шока, а белки VHH очищали с помощью аффинной хроматографии с иммобилизованными металлами (IMAC) с использованием автоматизированного протокола, реализованного на ÄKTXpress с последующей колонкой Hiload 16/60 Superdex 75 или Superdex 75 10/300GL с использованием фосфатно-солевого буфера. (PBS) буфер pH 7,4. C5-Fc был получен путем временной экспрессии в клетках expi293® и очищен с помощью комбинации HiTrap MabSelect SuRe™ (Cytiva) и гель-фильтрации в PBS pH 7.4 буфер. Тримерные версии нанотел были получены путем кратковременной экспрессии в клетках expi293® и очищены с помощью комбинации IMAC и гель-фильтрации в буфере PBS с pH 7,4. Для исследований на животных после IMAC (колонка GE, Capto S 1 мл) был введен дополнительный этап ионообменной хроматографии для снижения уровня эндотоксина, который был дополнительно снижен до <0,1 EU/мл путем пропускания конечного очищенного продукта через два Proteus NoEndo™. очистные колонки (Generon, Слау, Великобритания). Уровни эндотоксина определяли количественно с использованием набора для количественного определения хромогенных эндотоксинов Pierce™ LAL (Thermofisher Scientific).Белок концентрировали до 4 мг/мл и мгновенно замораживали для хранения при –80 °C. Биотинилированные и небиотинилированные RBD, ACE2-Fc и CR3022-Fc были получены путем временной экспрессии в клетках expi293® 25 . Вкратце, белки очищали из культуральных супернатантов через 72 часа после трансфекции с помощью аффинности иммобилизованного металла с использованием автоматизированного протокола, реализованного на ÄKTAxpress (GE Healthcare, Великобритания), с последующей колонкой Hiload 16/60 Superdex 75 или Superdex 200 10/300GL. с использованием фосфатно-солевого буфера (PBS) pH 7.4 буфер.

Все праймеры для ПЦР, использованные в этой работе, перечислены в дополнительной таблице 1, а последовательности нанотел представлены в дополнительной таблице 2. Векторы pOPINO для получения нанотел C1, C5, F2 и h4 были депонированы в Addgene (www.addgene.org). ) с идентификаторами 171924, 171925, 171926 и 171927.

Поверхностный плазмонный резонанс и ITC

Эксперименты по поверхностному плазмонному резонансу проводились с использованием Biacore T200 (GE Healthcare). Все анализы проводились с использованием рабочего буфера PBS pH 7.4 с добавлением 0,005% об./об. поверхностно-активного вещества Р20 (GE Healthcare) при 25 °C.

Конкурентный анализ проводили с использованием сенсорного чипа Protein A (Cytiva). В качестве лиганда использовали CR3022-Fc, ACE2-Fc или h21-h5-Fc, иммобилизовали ~1000 RU CR3022-Fc, ACE2-Fc или h21-h5-Fc. Были введены следующие образцы: (1) смесь 1 мкМ нанотел C1/C5/h4/F2 и 0,1 мкМ RBD-WT; (2) смесь 1 мкМ C2Nb6 (нанотело против Caspr2) и 0,1 мкМ RBD-WT; (3) 1 мкМ нанотел C1/C5/h4/F2; (4) 1 мкМ C2Nb6 и (5) 0.1 мкМ RBD-WT. Все кривые были построены с использованием GraphPad Prism 8.

Для определения кинетики связывания между RBD SARS-CoV-2 и нанотелом C1/C5/h4/F2 использовали набор Biotin CAPture Kit (Cytiva). Биотинилированные RBD были иммобилизованы на проточной кювете сенсорного чипа. Эталонная проточная кювета оставалась пустой. Нанотела вводили в две проточные кюветы в диапазоне пяти концентраций, полученных серийными двукратными разведениями, при скорости потока 30 мкл мин -1 с использованием кинетической программы с одним циклом.Текущий буфер также был введен с использованием той же программы для вычитания фона. Все данные были приспособлены к модели связывания 1:1 с использованием программного обеспечения Biacore T200 Evaluation Software 3.1.

Для определения кинетики связывания между RBD-WT SARS-CoV-2 и C5-Fc использовали набор Biotin CAPture Kit (Cytiva). Биотинилированный RBD иммобилизовали на проточной кювете сенсорного чипа. Эталонная проточная кювета оставалась пустой. C5-Fc вводили через две проточные кюветы в одной концентрации 10 нМ при скорости потока 30 мкл мин -1 .Текущий буфер также был введен с использованием той же программы для вычитания фона. Все данные были приспособлены к модели связывания 1:1 с использованием программного обеспечения Biacore T200 Evaluation Software 3.1.

Для определения кинетики связывания между RBD SARS-CoV-2 и тримерными нанотелами C1/C5/h4 использовали сенсорный чип-белок A (Cytiva). Версии RBD со слиянием Fc huIgG1 иммобилизовали на проточной кювете для образцов сенсорного чипа. Эталонная проточная кювета оставалась пустой. Тримерное нанотело вводили в две проточные кюветы в одной концентрации 25 нМ для тримера C1, 10 нМ для тримера C5 и 10 нМ (взаимодействие RBD-Кента) или 2.5 нМ (взаимодействие RBD-WT) для тримера h4 при скорости потока 30 мкл мин -1 . Текущий буфер также был введен с использованием той же программы для вычитания фона. Все данные были приспособлены к модели связывания 1:1 с использованием программного обеспечения Biacore T200 Evaluation Software 3.1.

Измерения методом изотермической титрационной калориметрии (ITC) проводились с использованием iTC200 и микрокалориметра PEAQ-ITC (GE Healthcare) при 25 °C. RBD и все нанотела диализовали в PBS, и титрование в RBD проводили с использованием от 150 до 25 мкМ нанотела и 14-2 мкМ RBD, за исключением Nb-h21 (470 мкМ) и RBD (47 мкМ).Для белка шипа 80-60 мкМ нанотела титровали до 8-6 мкМ шипа (концентрация мономера). Каждый эксперимент состоял из начальной инъекции 0,4 мкл с последующими 16–19 инъекциями 2–2,4 мкл нанотела в ячейку, содержащую RBD или шип, при перемешивании со скоростью 750 об/мин. Для анализа смещения ~ 200 мкМ нанотела C5 титровали в смеси 20 мкМ RBD и 100 мкМ h21, а 66 мкМ нанотела C5 титровали в смеси 6 мкМ шипа и 186 мкМ h21. Сбор и анализ данных выполняли с использованием пакета программного обеспечения для графического и аналитического анализа Origin (OriginLab) или AFFINImeter для глобальной подгонки анализа смещения.Для подгонки C5 и h21 к шипу использовали мономерную концентрацию шипа и единственный способ связывания. Анализ данных был выполнен путем создания изотермы связывания и наилучшего соответствия с использованием следующих параметров: N (количество участков), ΔH (кДжмоль -1 ), ΔS (JK -1 моль -1 ) и K (константа связывания в молях -1 ). После анализа данных K был преобразован в константу диссоциации (Kd).

Определение структуры комплексов VHH-RBD методом рентгеновской кристаллографии

Очищенные VHH смешивали с дегликозилированным RBD в молярном соотношении 1.2:1, и комплекс очищают эксклюзионной хроматографией, как описано 8 . Оптимальными условиями для кристаллизации каждого комплекса были F2-RBD 0,1 M янтарная кислота, дигидрофосфат натрия и глицин (SPG), pH 8, 25% полиэтиленгликоль (PEG) 1500, h4-C1-RBD и h4-C1-Alpha RBD. 1,0 М хлорида лития, 0,1 М лимонной кислоты, рН 4, 20% ПЭГ 6000 и C5-RBD 0,2 М ацетата натрия, 0,1 М какодилата натрия, рН 6,5, 30% масс./об. ПЭГ 8000 и C5-Alpha RBD 0,2 М фторида аммония и 20% ПЭГ 3350.Концентрация белка для всех комплексов составляла 18 мг/мл, за исключением F2-RBD, где использовали 34 мг/мл. Кристаллы выращивали при 20 °C методом диффузии паров сидячей капли путем смешивания 0,1 мкл белкового комплекса (C5-RBD) с 0,1 мкл резервуара; смешивание 0,2 мкл белкового комплекса (F2-RBD; h4-C1-RBD) с 0,1 мкл резервуара или 0,1 мкл белкового комплекса (C5-Alpha RBD; h4-C1-Alpha RBD) и 0,2 мкл резервуара, как указано выше. Кристаллы были криозащищены 30% глицерином, криоохлаждены в жидком азоте, данные дифракции собраны и обработаны на линиях пучка I03, I04 и I24 компании Diamond Light Source, Великобритания. Структуры были решены путем молекулярной замены с помощью PHASER 53,54 , как реализовано в CCP4 55 , с использованием отдельных компонентов комплекса между h21-h5 RBD 8 (PDB 6ZBP) в качестве поисковых моделей. Полученные структуры были восстановлены вручную с использованием COOT 56 и уточнены в REFMAC5 57 с помощью PDB-REDO 58 и MOLPROBITY 59 . Там, где использовались параметры TLS 60 , различные области белка идентифицировали с использованием сервера TLSMD 61 .Статистика обработки и уточнения данных представлена ​​в таблице 2.

Крио-ЭМ структуры

Подготовка крио-ЭМ сеток, сбор и обработка данных проводились, как описано ранее 8 . Вкратце, очищенный шиповидный белок в 10 мМ Hepes, рН 8, 150 мМ NaCl, при 1 мг/мл инкубировали с нанотелом С5, очищенным в PBS, при молярном соотношении 1:1,2 (шипообразный мономер:нанотело) при 16°С. с ночевкой. Прототип SPT Labtech 300 меш 1,2/2,0 нанопроволочные сетки подвергали тлеющему разряду при низкой температуре в течение 4 мин (Plasma Cleaner PDC-002-CE, Harrick Plasma) и использовали в системе Chameleon EP (SPT Labtech) при относительной влажности 80%, температуре окружающей среды. .Замороженные сетки были проверены, а данные собраны с использованием Titan Krios G2 (Thermo Fisher Scientific), оснащенного детектором Bioquantum-K3 (Gatan, Великобритания), работающим на 300 кВ. Статистика сбора данных представлена ​​в дополнительной таблице 3. Конвейер обработки RELION_IT.py, реализованный в eBIC, использовался для автоматической обработки данных вплоть до 2D-классификации. Сначала данные были обработаны как C1, но, поскольку комплекс показал симметрию C3, позже она была изменена на C3. Лучший 3D-класс был выбран для дальнейшего уточнения, уточнения CTF и полировки частиц в Relion.Была создана исходная модель на основе PDB ID 6VXX, а кристаллическая структура RBD-C5 помещена в плотность. Окончательная модель с коэффициентом корреляции 0,76 была создана путем нескольких циклов ручного вмешательства в coot 56 с последующим уточнением тела желе с помощью RefMac5 через CCP-EM GUI 53,54 . Проверка модели проводилась в PHENIX 62,63,64 . Статистика обработки и уточнения данных представлена ​​в таблице 3.

Анализ микронейтрализации

Тримеры VHH серийно разбавляли в модифицированной Дульбекко среде Игла (DMEM), содержащей 1% (масс./об.) эмбриональной телячьей сыворотки (FBS) в 96-луночном планшете. .Штаммы SARS-CoV-2 (B VIC01, B1.17 и B1.351) пассаж 4 (Vero 76 клон e6 [ECACC 85020206]) 9 × 10 4 БОЕ/мл, разбавленные 1:5 в DMEM-FBS, добавляли к каждую лунку со средой только в качестве отрицательного контроля. После инкубации в течение 30 мин при 37°С в каждую лунку добавляли клетки Vero (100 мкл) и планшеты инкубировали в течение 2 ч при 37°С. Затем в каждую лунку добавляли карбоксиметилцеллюлозу (100 мкл 1,5% об./об.) и планшеты инкубировали еще 18–20 ч при 37°С. Клетки фиксировали параформальдегидом (100 мкл на лунку, 4% по объему) в течение 30 минут при комнатной температуре, а затем окрашивали на нуклеопротеин SARS-CoV-2 с использованием моноклонального антитела человека (EY2A).Связанное антитело обнаруживали путем инкубации с конъюгатом козьего античеловеческого IgG HRP и после добавления субстрата визуализировали с использованием ридера ELISPOT. Титр нейтрализации определяли как титр тримера VHH, снижающий количество очагообразующих единиц (БОЕ) на 50% по сравнению с контрольными лунками.

Анализ PRNT

Тесты нейтрализации уменьшения зубного налета (PRNT) были проведены в Public Health England с использованием SARS-CoV-2 (hCoV-19/Австралия/VIC01/2020) (инвентарный номер GISAID EPI_ISL_406844) 65 любезно предоставлено The Институт Доэрти, Мельбурн, Австралия, на P1 и дважды пассирован в клетках Vero/hSLAM [ECACC 04091501].Вирус разводили до концентрации 933 p.f.u. мл -1 (70 БОЕ/75 мкл) и смешали 50:50 в минимальной основной среде (MEM; Life Technologies), содержащей 1% FBS (Life Technologies) и 25 мМ буфера HEPES (Sigma) с удвоением разведения антител в 96 пластина с V-образным дном. Планшет инкубировали при 37°С во влажном боксе в течение 1 ч для обеспечения нейтрализации. После этого смесь вирус-антитело переносили в лунки 24-луночного планшета, дважды промытого PBS Дульбекко, содержащего конфлюэнтные монослои клеток Vero E6 (ECACC 85020206, PHE), которые были культивированы в MEM, содержащей 10% (об. /об.) ФБС.Вирусу давали адсорбироваться на клетках при 37 °C в течение еще часа во влажном боксе, затем клетки покрывали МЕМ, содержащим 1,5% карбоксиметилцеллюлозы (Sigma), 4% (об./об.) FBS и 25  мМ буфера HEPES. После 5-дневной инкубации при 37 °C во влажном боксе планшеты фиксировали в течение ночи в 20% растворе формалина/PBS (об./об.), промывали водопроводной водой и затем окрашивали 0,2% раствором кристаллического фиолетового (Sigma) и подсчитывали бляшки. . Пробит-анализ средней точки (написанный на языке программирования R для статистических вычислений и графики) использовался для определения разведения антител, необходимого для уменьшения вирусных бляшек SARS-CoV-2 на 50% (ND50) по сравнению с контролем, содержащим только вирус ( n  = 5).Сценарий, использованный в R, был основан на ранее опубликованном исходном сценарии44. Разведения антител выполняли в двух повторах, и внутренний положительный контроль для анализа PRNT также выполняли в двух повторах с использованием образца инактивированной нагреванием (56 °C в течение 30 минут) выздоравливающей сыворотки MERS человека, pH 7,4, 137 мМ NaCl, 1 мМ CaCl 2 ) и 1 мг мл −1 трипсина (Sigma-Aldrich) для нейтрализации SARS-CoV-2 (Национальный институт биологических стандартов и контроля, Великобритания).

Оценка эффективности C5-Fc на модели сирийского хомяка (Общественное здравоохранение Англии) из Энвиго, Лондон, Великобритания.Хомяков распределяли случайным образом и размещали в индивидуальных клетках с доступом к пище и воде без ограничений. Все экспериментальные работы проводились в соответствии с одобренной Министерством внутренних дел Великобритании лицензией на проект, которая была подвергнута местной этической экспертизе в PHE Porton Down Органом по защите животных и этической экспертизе (AWERB) в соответствии с требованиями Министерства внутренних дел по животным (научные процедуры). Act 1986.

Двенадцать хомяков были кратковременно анестезированы 5% изофлураном (Zoetis, Leatherhead, UK) и 4 л/м O2 и интраназально инокулированы 5 × 10 4 p.f.u/животное SARS-CoV-2 (hCoV-19/Австралия/VIC01/2020), доставленное по 100 мкл на ноздрю (всего 200 мкл). В день 1 после контрольного заражения (pc) 6 хомяков обрабатывали 4 мг/кг C5 Nanobody внутрибрюшинным путем. Контрольные хомячки ( n  = 6) не получали лечения. Температуру (определяемую с помощью устройства для считывания микрочипов и имплантированного температурного/идентификационного чипа) и клинические признаки контролировали два раза в день, а вес измеряли один раз в день. Клинические признаки оценивались следующим образом; здоровый = 0, поведенческие изменения = 1, взъерошенный мех = 2, мокрый хвост = 2, обезвоженный = 2, закрытые глаза = 3, выгнутая спина = 3, осиная талия = 3 и затрудненное дыхание = 5.Клинические образцы смывов из носа в PBS Дульбекко (DPBS, Gibco) (200 мкл), а также мазки из ротоглотки (горла) (MWE, Corsham, UK) были получены до заражения (день -2) и на 2, 4, 6 дни. и 7 шт; животных подвергали кратковременной анестезии для сбора этих образцов. На 7-й день всех хомяков усыпили передозировкой анестетика (пентобарбитона натрия [Dolelethal, Vetquinol UK Ltd]) внутрибрюшинным путем. При вскрытии носовые смывы и мазки из ротоглотки и образцы тканей (легкие, трахея и двенадцатиперстная кишка) собирали в PBS и хранили в замороженном виде при -80°C для измерения вирусной РНК и вирусной культуры. Образцы тканей для гистопатологического исследования фиксировали в 10% забуференном формалине при комнатной температуре (см. ниже).

Анализ микробляшек 66 использовался для определения количества вируса в образцах тканей. Образец животного последовательно разбавляли в разбавителе для анализа (MEM с добавлением l-глютамина (Life Technologies), заменимых аминокислот (Life Technologies), 25 мМ HEPES (Sigma) и 1x антибиотика/антимикотика) и добавляли к конфлюэнтным монослоям Vero клетки Е6. Вирус адсорбировали на клетках в течение 1 часа при 37°С.Инокулят удаляли с клеточных планшетов и добавляли вязкое покрытие (1% карбоксиметилцеллюлоза, Sigma). Затем планшеты инкубировали в течение 24 часов при 37°С. Затем клетки фиксировали с использованием 8% формалина в течение >8 часов, после чего на фиксированных клетках выполняли протокол иммунного окрашивания (Bewley et al.). Окрашенные очаги [очагообразующие единицы (ФОЕ)] подсчитывали с помощью счетчика ELISpot (Cellular Technology Limited, США). Затем данные подсчитанных очагов были нанесены на график с использованием Graph Pad версии 9. Положительный контроль SARS-CoV-2 с концентрацией 1 × 10 5 БОЕ/мл анализировали вместе с образцами животных на каждом планшете для анализа, используя неинфицированный разбавитель для анализа в качестве отрицательного контроля. .

РНК выделяли из носовых смывов, мазков из ротоглотки и образцов тканей (легкие, трахея и двенадцатиперстная кишка). Взвешенные образцы тканей гомогенизировали и инактивировали в RLT (Qiagen) с добавлением 1% (об./об.) бета-меркаптоэтанола. Затем гомогенат ткани центрифугировали через гомогенизатор QIAshredder (Qiagen) и добавляли этанол в соответствии с инструкциями производителя. Далее проводили экстракцию с использованием ветеринарного набора BioSprint™96 One-For-All (Indical Bioscience) и платформы Kingfisher Flex в соответствии с инструкциями производителя.Образцы, не относящиеся к тканям, инактивировали в AVL (Qiagen) и этаноле с окончательной экстракцией с использованием ветеринарного набора BioSprint™96 One-For-All (Indical Bioscience) и платформы Kingfisher Flex в соответствии с инструкциями производителя. Количественную полимеразную цепную реакцию с обратной транскрипцией (RT-qPCR) проводили с использованием TaqPath™ 1-Step RT-qPCR Master Mix, CG (Applied Biosystems™), 2019-nCoV CDC RUO Kit (Integrated DNA Technologies) и QuantStudio™ 7 Flex Real. -Система временной ПЦР. Последовательности праймеров и зонда N1 были следующими: 2019-nCoV_N1-вперед, 5′-GACCCCAAAATCAGCGAAAT 3′; 2019-nCoV_N1-обратный, 5′ TCTGGTTACTGCCAGTTGAATCTG 3′; 2019-nCoV_N1-зонд, 5′ FAM-ACCCGCATTACGTTTGGTGGACC-BHQ1 3′.Условия циклирования: 25°С в течение 2 мин, 50°С в течение 15 мин, 95°С в течение 2 мин, затем 45 циклов: 95°С в течение 3 с, 55°С в течение 30 с. Стандартом количественного определения была транскрибированная in vitro РНК N ORF SARS-CoV-2 (инвентарный номер NC_045512.2) с количественным определением от 10 до 1 × 10 6 копий/мкл. Положительным образцам, обнаруженным ниже нижнего предела количественного определения (LLOQ) 10 копий/мкл, было присвоено значение 5 копий/мкл, необнаруженным образцам было присвоено значение 2,3 копий/мкл, что эквивалентно анализу LLOD. Для образцов смывов из носа и мазков из ротоглотки это соответствует LLOQ 1,29 × 10 4 копий/мл и LLOD 2,96 × 10 3 копий/мл. Образцам, обнаруженным между LLOQ и LLOD, было присвоено значение 6,43 × 10 3 копий/мл. Для образцов тканей это соответствует LLOQ 1,31 × 10 4 копий/г и LLOD 5,71 × 10 4 копий/г. Образцам, обнаруженным между LLOQ и LLOD, было присвоено значение 2,86 × 10 4 копий/г.

Субгеномную RT-qPCR выполняли на системе ПЦР в реальном времени QuantStudio™ 7 Flex с использованием TaqMan™ Fast Virus 1-Step Master Mix (Thermo Fisher Scientific) и олигонуклеотидов, как указано Wolfel et al. 67 , с прямым праймером, зондом и обратным праймером в конечной концентрации 250 нМ, 125 нМ и 500 нМ соответственно. Последовательности праймеров и зонда sgE были следующими: 2019-nCoV_sgE-forward, 5′ CGATCTCTTGTAGATCTGTTCTC 3′; 2019-nCoV_sgE-reverse, 5′ ATATTGCAGCAGTACGCACACA 3′ и 2019-nCoV_sgE-зонд, 5′ FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 3′. Условия циклирования: 50°С в течение 10 мин, 95°С в течение 2 мин, затем 45 циклов при 95°С в течение 10 с и 60°С в течение 30 с. Ампликоны RT-qPCR количественно определяли в сравнении со стандартом транскрибируемой in vitro РНК полноразмерной ORF SARS-CoV-2 E (номер доступа NC_045512.2), которому предшествует лидерная последовательность UTR и предполагаемая регуляторная последовательность транскрипции гена Е, описанная Wolfel et al. в 2020 г. 49. Положительным образцам, обнаруженным ниже нижнего предела количественного определения (LLOQ), было присвоено значение 5 копий/мкл, в то время как необнаруженным образцам было присвоено значение ≤0,9 копий/мкл, что эквивалентно нижнему пределу обнаружения анализа ( ЛЛОД). Для образцов, извлеченных из назальных смывов и мазков из ротоглотки, это соответствует LLOQ, равному 1,29 × 10 4 копий/мл, и LLOD, равному 1.16 × 10 3 копий/мл. Для образцов ткани это соответствует LLOQ 5,71 × 10 4 копий/г и LLOD 5,14 × 10 3 копий/г.

Легкие, полость носа, включая слизистую оболочку обоняния и дыхательных путей, сердце, печень, селезенку, поджелудочную железу, головной мозг трахеи/гортани и тонкую кишку (двенадцатиперстную кишку) брали у каждого животного и фиксировали в 10% нейтральном забуференном формалине, обрабатывали, заливали в парафиновом воске и вырезаны срезы толщиной 4 мкм и окрашены гематоксилином и эозином (H&E).Срезы тканей были отсканированы в цифровом виде и рассмотрены квалифицированным ветеринарным патологоанатомом, который не знал о лечении и деталях группы, а предметные стекла были рандомизированы перед исследованием, чтобы предотвратить систематическую ошибку (слепая оценка). Для объективной оценки гистопатологических поражений, наблюдаемых в срезах тканей, использовалась балльная система: 0 = в пределах нормы; 1 = минимальный; 2 = легкий; 3 = умеренное и 4 = выраженное/тяжелое. Кроме того, площадь легкого с пневмонией рассчитывали с помощью анализа цифровых изображений (программный комплекс Nikon-NIS-Ar).

РНКоскоп (метод гибридизации in situ, используемый на фиксированных формалином и залитых парафином тканях) использовался для идентификации вируса SARS-CoV-2 во всех тканях. Вкратце, ткани предварительно обрабатывали перекисью водорода в течение 10 минут при комнатной температуре (КТ), целевым извлечением в течение 15 минут (98–101 °C) и протеазой плюс в течение 30 минут (40 °C) (все Advanced Cell Diagnostics). Зонд V-nCoV2019-S (Advanced Cell Diagnostics), нацеленный на ген S-белка, инкубировали на тканях в течение 2 ч при 40°C. Амплификацию сигнала проводили по протоколу RNAscope (RNAscope 2.5 HD Detection Reagent — Red) с использованием красного набора RNAscope 2.5 HD (Advanced Cell Diagnostics). Соответствующие элементы управления были включены в каждый запуск ISH. Анализ цифровых изображений проводили с помощью программного пакета Nikon NIS-Ar, чтобы рассчитать общую площадь среза ткани, положительного на наличие вирусной РНК. Изображения были отсканированы в цифровом виде с использованием цифрового сканера слайдов Hamamatsu NanoZoomer S360 и исследованы с использованием программного обеспечения Ndp. view2 v2.9.22. Программное обеспечение Nikon NIS-Ar использовалось для анализа цифровых изображений с целью количественного определения присутствия вирусной РНК в срезах легких.Графики и статистический анализ были выполнены с помощью Graphpad Prism 9 и Minitab версии 16.

Оценка терапевтической эффективности тримера С5 на модели сирийского хомяка (Ливерпульский университет) Тело и выполняется в соответствии с лицензией на проект Министерства внутренних дел Великобритании PP4715265. Самцов золотистых сирийских хомяков (возраст 8–10 недель) приобретали в компании Janvier Labs (Франция). Животных содержали в условиях SPF-барьера в индивидуально вентилируемых клетках.Для вирусной инфекции использовали штамм Liverpool, штамм PANGO линии B SARS-CoV-2 (hCoV-2/human/Liverpool/REMRQ0001/2020)

68 . Животных случайным образом распределяли на несколько когорт по 6 животных. В случае заражения SARS-CoV-2 хомяков слегка анестезировали изофлураном и интраназально инокулировали 100 мкл, содержащих 10 4 БОЕ SARS-CoV-2 в PBS. Хомячкам вводили 100 мкл либо внутрибрюшинно, либо интраназально тримером C5, содержащимся в PBS.Животных убивали в различные моменты времени после заражения передозировкой пентабарбитона. Ткани были немедленно удалены для последующей обработки.

Левое легкое всех животных фиксировали в 10% забуференном формалине на 48 ч, а затем хранили в 70% этаноле до дальнейшей обработки. Были приготовлены два продольных среза и стандартно залиты парафином. Готовили последовательные срезы (3–5 мкм) и окрашивали HE для гистологического исследования или подвергали иммуногистологическому окрашиванию.Иммуногистологию проводили для выявления антигена SARS-CoV-2, макрофагов (Iba1+), пневмоцитов II типа (SP-C+) и эпителиальных клеток (панцитокератин+) с использованием метода пероксидазы хрена (HRP) и следующих первичных антител: кроличьи анти -Нуклеокапсидный белок SARS-CoV (1:6000, Rockland, 200-402-A50), кроличьи антитела к человеческому Iba1/AIF1 (1:1000, Wako, 019-19741), кроличьи антитела к человеческому просурфактантному белку-C (1: 4000, SP-C; Abcam, ab40879) и мышиное антитело к панцитокератину человека (1:10000, клон PCK-26; Novus Biologicals, NB120-6401). Вкратце, после депарафинирования срезы подвергали извлечению антигена в цитратном буфере (pH 6,0; Agilent) (анти-SARS-CoV-2, -Iba1) или трис-ЭДТА-буфере (pH 9,0) (анти-SP-C, -pan -цитокератин) в течение 20 мин при 98°С и 20 мин при 37°С соответственно с последующей инкубацией с первичным антителом в течение ночи при 4°С (анти-SARS-CoV, SP-C) или 60 мин при комнатной температуре (анти -Iba1, -пан-цитокератин). За этим последовало блокирование эндогенной пероксидазы (блокировка пероксидазы, Agilent) в течение 10  мин при комнатной температуре (КТ) и инкубация со вторичным антителом, EnVision+/HRP, кролик и мышь соответственно (неразбавленный готовый к использованию реагент, Agilent K406311- 2) в течение 30 минут при комнатной температуре, затем EnVision FLEX DAB++Chromogen в субстратном буфере (Agilent) в течение 10 минут при комнатной температуре, все в автостейнере (Dako).Затем срезы докрашивали гематоксилином. Антитела против Iba1, -SP-C и -pan-cytokeratin тестировали на их перекрестную реактивность в тканях хомячка, используя легкие неинфицированного контрольного хомяка в качестве положительного контроля.

Для двойной иммунофлуоресценции срезы подвергали извлечению антигена в цитратном буфере (pH 6,0), а затем инкубировали с первым первичным антителом (кроличьи анти-SARS-CoV) в течение ночи при 4 °C с последующим блокированием эндогенной пероксидазы (см. выше) и 1 ч инкубации с антителом, меченым красной флуоресценцией (1:500, козье анти-кроличье 594; Invitrogen, A11012), инкубацией со вторым первичным антителом (1:400, козьего античеловеческого Iba1; Abcam, ab 5076) , в течение ночи при 4°C и 1 ч инкубации с антителом, меченым зеленой флуоресценцией (1:500, осел против козла 488; Invitrogen, A1105).Заключительную инкубацию проводили с DAPI (4′, 6-диамидино-2-фенилиндол, Novus Biologicals) в течение 15 мин при комнатной температуре. После этого срезы дважды промывали дистиллированной водой, сушили на воздухе и помещали на покровное стекло с заливочной средой FluoreGuard (Biosystems, Швейцария).

Для морфометрического анализа окрашенные HE срезы сканировали (NanoZoomer-XR C12000; Hamamatsu, Hamamatsu City, Japan) и анализировали с использованием программного обеспечения Visiopharm (Visiopharm 2020. 08.1.8403; Visiopharm, Hoersholm, Дания) для количественного определения площади неаэрируемая паренхима и аэрированная паренхима по отношению к общей площади (= площадь, занятая легочной паренхимой на двух срезах, приготовленных из левых долей легкого) на срезах.Это использовали для сравнения объема воздушного пространства (в качестве эквивалента поверхности газообмена) в легких у необработанных и обработанных животных. Было применено первое приложение, которое обозначило всю легочную ткань как область интереса (ROI, общая площадь). Для этого был использован метод Decision forest и программное обеспечение было обучено обнаруживать срез легочной ткани (общая площадь). Как только секция легкого была обозначена как ROI, крупные бронхи и сосуды были вручную исключены из ROI. Впоследствии второе приложение с методом Decision forest было обучено обнаруживать плотную паренхиму (невентилируемые) и альвеолярные пространства (свободные пространства; вентилируемая область) в области интереса.

Сводка отчета

Дополнительная информация о дизайне исследования доступна в Сводке отчета об исследовании природы, связанной с этой статьей.

Сирийский хомяк раскрывает воспалительные процессы при COVID-19

Размножающиеся вирусы, разрушающие легочную ткань, не вызывают напрямую тяжелых исходов болезни COVID-19, вместо этого ответственны воспалительные иммунные процессы, поражающие эндотелиальную выстилку дыхательных путей, сообщается в новом исследовании. Клеточные механизмы на ранних стадиях воспаления эндотелия легких при инфекции SARS-CoV-2 до сих пор плохо изучены.

В новом исследовании используются модели сирийских хомяков с умеренной формой заболевания COVID-19, чтобы лучше понять системные и легочные клеточные реакции и сопоставить их с исходами тяжести в наборах данных пациентов с COVID-19. Исследование показывает, что макрофаги, поглощающие патогены в легких, первыми и сильнее всего реагируют на инфекцию. Даже в то время как клетки, выстилающие легочные пассажи, демонстрируют умеренные изменения в экспрессии генов, макрофаги обновляют свой транскрипционный механизм сразу после заражения и увеличивают производство провоспалительных генных продуктов.

При отсутствии высвобождения вирусных частиц из инфицированных клеток (продуктивная инфекция) ответ эндотелиальных клеток в легких зависит от клеточного подтипа и включает сильную раннюю индукцию провоспалительных генов и генов, привлекающих Т-клетки к организовать иммунный ответ против инфекции. Прежде чем вирус будет элиминирован из организма примерно через пять дней после заражения, в легкие рекрутируются Т-клетки-киллеры, которые убивают зараженные вирусом клетки, и антитела иммуноглобулина М.

Сотрудничающие ученые из нескольких исследовательских институтов Германии, включая ученых из Charité—Universitätsmedizin, Центра молекулярной медицины Макса Дельбрюка (MDC) и Свободного университета в Берлине, сообщают об этих выводах в статье Nature Communications «Анализ темпоральной омики у сирийских хомяков». распутать клеточные эффекторные ответы на умеренный COVID-19». Исследование выявляет эффекторные функции специфического типа клеток, обеспечивая подробное понимание патологических механизмов COVID-19 и информируя о будущих терапевтических стратегиях. Финансовую поддержку этому исследованию оказали Немецкий исследовательский фонд и Берлинский институт здравоохранения.

Уже на второй день после заражения SARS-CoV-2 (красный) проникает почти во все области легких (инфицированная легочная ткань, изображение A). Вирус проникает и разрушает как клетки, выстилающие дыхательные пути (В, наконечник стрелки), так и клетки, ответственные за газообмен (указатели стрелки). В макрофагах можно обнаружить многочисленные вирусные частицы (E, значок стрелки) [Dietert Gruber/ Freie Universität Berlin]. Авторы подчеркивают, что сирийский хомяк является идеальной моделью для исследования инфекций SARS-CoV-2.Ориентированные на пациента исследования по определению терапевтических мишеней для COVID-19 и пониманию основных механизмов заболевания, особенно на ранних стадиях инфекции, ограничены по своему масштабу. Биологические образцы, необходимые для этого типа исследований, обычно можно получить только после госпитализации пациента. Кроме того, практически невозможно получить образцы легочной ткани у пациентов с легким или умеренным заболеванием и пневмонией, поскольку процедура биопсии подвергает пациентов неоправданному риску. Поэтому большинство исследований, ориентированных на пациента, основано на анализе тканей, полученных после смерти.

Исследователи в текущем исследовании использовали доступные образцы пациентов, чтобы лучше понять механизмы прогрессирования обоих заболеваний, но они также искали подходящую животную модель, которая позволила бы им изучить отделы легких, важные на ранней стадии заболевания, которые труднодоступны. у пациентов.

«Мы хотели узнать, можем ли мы использовать эти модели для разработки новых вариантов лечения, и попытались воспроизвести результаты исследований образцов пациентов.Мы добились значительных успехов в этом отношении», — говорит Мартин Витценрат, доктор медицинских наук, заместитель заведующего и профессор кафедры инфекционных заболеваний и респираторной медицины Charité, соавтор исследования.

«В первую очередь нас интересовали эндотелиальные клетки легких, которые выстилают легочные кровеносные сосуды и образуют там барьер. В тяжелых случаях COVID-19 этот барьер становится дисфункциональным, что в конечном итоге приводит к легочной недостаточности».

С целью определения идеальной модели нетрансгенного животного для исследования методов лечения COVID-19 исследователи описывают подробные характеристики инфекции SARS-CoV-2 на модели сирийского хомяка и подтверждают свои выводы наборами данных из образцов пациентов. .

Хомячки заражаются теми же вариантами вируса, что и люди. У них также развиваются схожие симптомы заболевания, и тяжелое заболевание повреждает их легкие. Однако симптомы и прогрессирование COVID-19 различаются у разных видов хомяков. В то время как у сирийских хомяков симптомы обычно остаются умеренными, у хомяков Роборовского заболевание развивается тяжело. Авторы проводят анализ отдельных клеток, чтобы выявить основные механизмы, ответственные за различия в результатах тяжести в моделях хомяков, сосредоточив внимание на процессах в эндотелиальных клетках легких.

«Мы смогли наблюдать, как определенные клетки, участвующие в иммунитете легких, а именно моноциты и производные от моноцитов макрофаги, поглощают вирус и впоследствии проявляют очень выраженный ответ. Они посылают биологических мессенджеров, которые затем вызывают очень сильную воспалительную реакцию. В нашей модели это быстро контролируется Т-клетками, другим типом иммунных клеток, которые направляются именно для этой цели. Однако при тяжелом течении COVID-19 этого не происходит», — говорит Джеральдин Нуай, доктор медицинских наук, научный сотрудник отдела инфекционных заболеваний и респираторной медицины Charité и соавтор исследования.«Быстрый и эффективный ответ Т-клеток имеет решающее значение для успешного выздоровления от COVID-19».

На ранних стадиях инфекции SARS-CoV-2 медленно размножается в легких и дыхательных путях, в то время как иммунный ответ становится чрезмерным.

Эндотелиальные клетки, выстилающие кровеносные сосуды (указатель стрелки), не инфицированы, но их сильный ответ на вирус вызывает приток воспалительных клеток, прежде всего Т-клеток (указатель стрелки). Стержни: 50 мкм. [Дитерт Грубер/ Свободный университет Берлина] «Разрушение легочной ткани, наблюдаемое при тяжелом течении COVID-19, является не прямым результатом размножения вируса внутри клеток, а сильным воспалительным ответом», — говорит Эмануэль Вайлер, исследователь из MDC, и соавтор исследования. «По-видимому, это также относится к клеткам сосудистой системы, в частности к эндотелиальным клеткам легких. Они демонстрируют очень сильную реакцию на вирус, но не заражаются им и не уничтожаются в процессе».

Если болезнь протекает тяжело, кровеносные сосуды могут стать закупоренными, а стенки сосудов нестабильными, что приведет к острой легочной недостаточности. Однако маловероятно, что это повреждение кровеносных сосудов также играет роль при COVID-19 средней степени тяжести.

«То, что COVID-19 активирует эндотелий — тип защитного барьера, выстилающего кровеносные сосуды, который, среди прочего, также контролирует ряд процессов в микрососудах легких, — не стало неожиданностью.Однако неожиданностью стало то, что эти клетки также являются активным двигателем воспаления», — говорит Витценрат.

На эндотелиальные клетки можно воздействовать терапевтически с помощью веществ, которые либо запечатывают, либо успокаивают эндотелиальный барьер.

«Один из них уже является объектом исследования, проведенного в нашем Центре совместных исследований SFB-TR84, где мы смогли показать, что он эффективен при пневмонии и у пациентов, находящихся на ИВЛ», — говорит Витценрат. Другие противовоспалительные препараты, которые в настоящее время проходят испытания в качестве лечения COVID-19, нацелены на сам иммунный ответ.Они также эффективны против моноцитов и макрофагов и снижают их активность.

Исследователи надеются использовать модель сирийского хомяка для разработки безопасных и эффективных методов лечения пациентов с COVID-19. Многопрофильная группа исследователей в настоящее время анализирует реакции различных типов клеток, наблюдаемые у карликовых хомяков Роборовского. Исследователи хотят выяснить, почему инфекция вызывает тяжелое заболевание у этих животных и почему она не проходит сама по себе, как у сирийских хомяков.

«Мы надеемся, что это приведет нас к возможному объяснению того, почему у одних людей развивается тяжелая форма COVID-19, а у других — нет», — говорит Нуай. Исследователям нужно будет сначала расшифровать геном джунгарского хомяка, чтобы заполнить пробел в знаниях относительно экзотической модели.

«Информация из нашего текущего исследования позволила нам закрыть некоторые из этих пробелов. Это представляет собой значительный прогресс, в том числе с точки зрения более сознательного и целенаправленного подхода к использованию животных в медицинских исследованиях», — говорит Якоб Тримперт, доктор философии, вирусолог и ветеринарный хирург из Свободного университета Берлина и соавтор статьи.

Сирийские хомячки как модель мелких животных для новых инфекционных заболеваний: достижения в иммунологических методах

2.1 qRT-PCR

Хотя количественная полимеразная цепная реакция с обратной транскриптазой (qRT-PCR) была методом выбора в диагностике, обнаружении патогенов, и определение вирусной нагрузки, потенциал использования qRT-PCR для определения иммунных ответов в тканях был реализован во многих моделях. Например, в человеческих моделях кОТ-ПЦР применялась для обнаружения врожденных цитокинов и факторов транскрипции, участвующих в иммунных реакциях в клетках, инфицированных коронавирусом SARS, обнаружения активированных генов, участвующих в иммунном ускользании в циркулирующих опухолевых клетках, и оценки иммунного ответа. реакции, возникающие у пациентов, получавших живую аттенуированную вакцину против желтой лихорадки (Zielecki et al.2013; Штайнерт и др. 2014; Гоше и др. 2008). Аналогичным образом, у мышей метод qRT-PCR использовался для описания механизмов иммунной активации в некоторых моделях вакцин, для определения факторов транскрипции, участвующих в опосредованной дендритными клетками презентации антигена и последующей активации Т-клеток, для исследования механизмов, стоящих за макрофагами. поляризации и оценить роль определенных подмножеств Т-клеток в моделях инфекционных заболеваний (Pollard et al., 2013; Seillet et al., 2013; Davis et al.2013; Стросс и др. 2012). Несмотря на то, что во многих моделях qRT-PCR используется для определения относительной экспрессии генов как врожденных, так и адаптивных цитокинов и хемокинов (Zivcec et al., 2011; Safronetz et al., 2011a; Prescott et al., 2013; Overbergh et al. 2003), приведенные выше примеры иллюстрируют, что способность обнаруживать мРНК других нецитокиновых и нехемокиновых генов, таких как факторы транскрипции и маркеры клеточной поверхности, может играть ценную роль в оценке иммунитета, генерируемого в определенных случаях (Gaucher et al. 2008 г.; Сейле и др. 2013). Тот факт, что qRT-PCR используется в таких моделях, как модели человека и мыши, благодаря чему иммунологические реагенты легко доступны, а многие аспекты специфического иммунитета могут быть относительно легко проанализированы с использованием других методов, показывает ценность и актуальность qRT-PCR среди доступных сегодня анализов. .

У хомяков метод qRT-PCR в настоящее время является методом выбора для многих при оценке иммунного ответа в моделях инфекционных заболеваний. Недавно была описана панель анализов прайм/зонд TaqMan® для 51 целевого гена хомяка, которые были выбраны из набора из более чем 800 эталонных последовательностей мРНК в GenBank (Zivcec et al.2011). Каждый из них участвует либо в провоспалительных, противовоспалительных, врожденных иммунных реакциях, реакциях Т-клеток, а также в неиммунных путях, таких как апоптоз, клеточные соединения или реакции коагуляции у хомяков (Zivcec et al. 2011). Кроме того, одновременно была проведена валидация подходящего гена домашнего хозяйства для использования в анализах qRT-PCR у хомяка, при этом рибосомный белок L18 (RPL18) был идентифицирован как наиболее стабильный из протестированных генов домашнего хозяйства среди β-актина, β-2-микроглобулина. и гипоксантинфосфорибозилтрансферазу (Zivcec et al.2011). Следовательно, использование qRT-PCR на моделях хомяков в качестве иммунологического инструмента значительно возросло. qRT-PCR использовался на моделях хомяков, изучающих заболевания, вызванные вирусом Анд (Safronetz et al., 2011a, b; Prescott et al., 2013), геморрагической лихорадкой, вызванной вирусом Эбола (Ebihara et al., 2012), вирусом Nipah (DeBuysscher et al. 2013) и Leishmania spp. (da Silva-Couto et al. 2015) среди прочих.

Разработка специальных наборов праймеров/зондов для использования в qRT-PCR на хомяках улучшила ограниченные возможности, доступные исследователям, которые хотят использовать хомяков в качестве модели на мелких животных.Это достижение позволяет обнаруживать широкий спектр иммунных и клеточных факторов и имеет решающее значение для расширения использования хомяков в качестве модели на животных. Тем не менее, хотя qRT-PCR, по всей вероятности, является лучшим иммунологическим инструментом, доступным в настоящее время для хомяков, он по-прежнему имеет существенные недостатки. Во-первых, количество генов, связанных с иммунной системой, которые были секвенированы, и их последовательности мРНК, введенные в GenBank, все еще относительно невелики. Подтвержденная панель праймеров содержала только 51 ген, которые играли роль в иммунных реакциях хозяина (таблица 2) (Zivcec et al.2011). В то время как многие из генов, о которых сообщают, играют важную роль в иммунитете хозяина, количество иммунных факторов, которые можно анализировать, меркнет по сравнению с тем, что доступно в анализах на мышах и людях. Во-вторых, хотя изучение связанных с иммунитетом генов, вовлеченных в системы болезней, может дать ценную информацию о классе генерируемого иммунитета или о том, какой тип иммунитета необходим для защиты от определенных патогенов, относительное количество присутствующей мРНК не всегда прямо коррелирует с количество экспрессируемого белка (Overbergh et al.2003). Во многих случаях присутствие экспрессированного белка будет очень небольшим, в связи с чем вместо этого необходимо использовать qRT-PCR и относительную экспрессию генов. В этих случаях, и особенно при использовании qRT-PCR для анализа экспрессии генов, связанных с иммунной системой, у хомяков следует учитывать несоответствие между уровнями мРНК и белка (Overbergh et al. 2003). Несмотря на это, есть доказательства того, что в некоторых случаях существует хорошая корреляция между уровнями мРНК и белка (Hein et al. 2001; Blaschke et al.2000). Наконец, методы, используемые для сбора тканей хомяков для анализа с помощью qRT-PCR, в большинстве моделей не позволяют оценить экспрессию специфического гена в отдельных типах клеток. Возможно, наиболее важным недостатком, который следует учитывать при использовании qRT-PCR для анализа экспрессии генов, связанных с иммунитетом, является то, что ткани хомяка часто собирают, а общую РНК извлекают из тканей для анализа с помощью qRT-PCR (Safronetz et al. 2011a; Prescott). и др., 2013; Чаттопадхьяй и др., 2014). Отсутствие хомячковых специфических антител не позволяет выделить отдельные типы клеток для анализа экспрессии генов. Таким образом, обнаружение антиген-специфических иммунных ответов на уровне отдельных клеток практически невозможно, остаются только системные ответы и общие маркеры цитокинов, хемокинов и других маркеров. Это может вызвать проблемы при попытке обнаружить первичный и вторичный иммунный ответ, определить, какие типы врожденных клеток играют роль в защите от патогенов, а также определить корреляты защиты от определенных заболеваний.

До тех пор, пока в продажу не поступит больше специфичных для хомяков моноклональных антител, qRT-PCR для определения относительных уровней экспрессии генов иммунного ответа является одним из лучших инструментов, имеющихся в распоряжении исследователей на сегодняшний день.Несмотря на определенные недостатки, такие как количество существующих аналитов для тестирования и присущие анализу проблемы, такие как расхождения между уровнями мРНК и белка и невозможность различения определенных типов клеток, qRT-PCR стала стандартным иммунологическим методом для использования у хомяков. модели. Он позволяет одновременно обнаруживать большое количество иммунных маркеров (таблица 2) и представляет собой надежный и чувствительный анализ с типичным пределом обнаружения от 10 -6 до 10 -8 нг геноспецифичной РНК. , что соответствует приблизительно 9–900 копий РНК (Chattopadhyay et al.2014). qRT-PCR — один из наиболее ценных методов иммунологического анализа на моделях хомяков.

2.2 ELISA

Иммуноферментный анализ (ELISA) стал стандартной практикой для обнаружения цитокинов, антител и других белков с момента его описания в 1971 г. Энгваллом и Перлманном (Engvall and Perlmann 1971). Первоначально описанный как метод обнаружения IgG-антител, ELISA впоследствии был разработан и оптимизирован для обнаружения широкого спектра белков, наиболее распространенными из которых являются цитокины, которые можно обнаружить в биологических образцах (Hornbeck 1991).Для таких видов, как мыши, нечеловекообразные приматы и люди, можно приобрести большое количество коммерчески доступных наборов по разумной цене для обнаружения почти всех важных цитокинов или хемокинов. Кроме того, легко доступны антитела против цитокинов этих видов, в том числе антитела с ферментативными конъюгатами, что позволяет оптимизировать индивидуальные протоколы по вкусу каждого исследователя. Однако у хомяков эти антитела для обнаружения цитокинов недоступны.Исследование, изучающее перекрестную реактивность белков хомячка, показало, что из 64 анализов на основе антител, включая luminex и ELISA для обнаружения цитокинов и хемокинов у различных видов, 14 показали значительную перекрестную реактивность с белками хомячка (Zivcec et al. 2011). Из восьми испытанных наборов ELISA только три показали приемлемый уровень перекрестной реактивности с белками хомячка (Zivcec et al. 2011). Из-за высокого уровня гомологии последовательностей генов этих белков у тестируемых видов по сравнению с хомяками этот низкий процент перекрестной реактивности является неожиданным.Из этих экспериментов авторы пришли к выводу, что наборы ELISA и наборы для обнаружения цитокинов и хемокинов у других видов, таких как мыши и крысы, малоэффективны для использования у хомяков (Zivcec et al. 2011).

Из-за отсутствия антител для обнаружения цитокинов хомяков следует, что другой ценный и родственный иммунный анализ, иммуноферментный анализ пятен (ELISPOT), также не имеет большого значения при использовании модели хомяка. Этот анализ обнаруживает отдельные клетки, продуцирующие цитокины, в культуре, а не присутствие цитокинов в супернатанте культуры или сыворотке, но аналогичным образом использует антитела против цитокинов для обнаружения клеток, секретирующих цитокины.Отсутствие антител, которые могут обнаруживать специфические цитокины хомяков, ограничивает использование как ELISA, так и ELISPOT для обнаружения цитокинов в моделях хомяков. Разработка моноклональных антител против различных цитокинов у хомяков значительно увеличила бы количество анализов, которые можно было бы использовать для изучения иммунных реакций у хомяков.

Несмотря на невозможность использования ИФА для обнаружения цитокинов у хомяков, ИФА все еще может быть ценным инструментом для обнаружения антител на моделях хомяков. В соответствии со своим первоначальным назначением, ИФА можно использовать для количественного определения присутствия IgM и IgG хомяков. Из ограниченного числа имеющихся в продаже антител против хомяков доступны антитела против хомячков IgM и IgG, которые использовались для демонстрации присутствия антиген-специфических антител в различных моделях хомяков (Safronetz et al. 2009; Prescott et al. 2015; де Вит и др., 2013). В целом, использование прямого анализа ELISA идеально подходит для обнаружения антител в сыворотке хомяков. Следовательно, необходимо покрыть планшеты для ИФА рекомбинантным или очищенным антигеном, прежде чем можно будет добиться обнаружения специфических антител в сыворотке.Это было выполнено на моделях хантавирусного сердечно-легочного синдрома, вызванного вирусом Анд (Safronetz et al. 2009), геморрагической лихорадки Эбола (Prescott et al. 2015) и MERS-CoV (de Wit et al. 2013) среди прочих. Это предоставило ценный инструмент для оценки гуморального иммунитета у хомяков в ответ на инфекционные агенты.

Несмотря на ценность возможности обнаружения IgM и IgG у хомяков, это единственные два изотипа, против которых в настоящее время имеются доступные антитела.Обнаружение различных изотипов, таких как IgG1 и IgG2, будет иметь неоценимое значение для исследователей при оценке иммунного ответа, учитывая другие ограниченные возможности, доступные у хомяков. Кроме того, возможность обнаружения IgE, IgA и IgD, также важных участников многих иммунных моделей, повысит ценность использования хомяков в качестве модели на животных. Опять же, отсутствие специфических реагентов для хомяков ограничивает возможность изучения всего спектра иммунного ответа. В настоящее время нам осталось определить титры специфичных для хомяков IgM и общего IgG до тех пор, пока не будут разработаны антитела для дальнейшего обнаружения.

2.3 Проточная цитометрия

Использование проточной цитометрии для обнаружения определенных типов клеток стало стандартной иммунологической практикой. Проточная цитометрия может определить наличие специфических маркеров на клетках, статус активации лимфоцитов, наличие определенных субпопуляций клеток в тканях и какие субпопуляции клеток продуцируют определенные цитокины. Кроме того, сортировка клеток с активированной флуоресценцией (FACS) может сортировать типы клеток при распознавании флуоресцентных маркеров, связанных с клетками через специфические антитела.Специфичность и чувствительность проточной цитометрии, наряду с появлением больших панелей, способных распознавать более дюжины флуоресцентных маркеров на клетках, делают ее одним из самых ценных инструментов для иммунологического анализа. Для хомяков в настоящее время нет моноклональных антител против маркеров клеточной поверхности, специфичных для клеток хомяков, для использования в проточной цитометрии. Однако во многих исследованиях использовались перекрестно-реактивные антитела против маркеров клеточной поверхности мышей и крыс для использования в проточной цитометрии (Prescott et al.2013; Хаммербек и Хупер, 2012). Хаммербек и Хупер сообщили, что из панели, состоящей из 52 коммерчески доступных антител для использования в проточной цитометрии, четыре смогли идентифицировать клетки хомяка (Хаммербек и Хупер, 2012). Четыре перекрестно-реактивных антитела включали антитела против мышиного/крысиного MHC II (IE k ), анти-мышиный CD4, анти-крысиный CD8β и анти-мышиный Thy1.2 (Hammerbeck and Hooper 2012). ранее сообщалось о перекрестной реакции с клетками хомяка (Dondji et al.2008 г.; Лю и др. 1990). Антитела против IgM и IgG хомяка также можно использовать для обнаружения В-клеток хомяка в проточной цитометрии (Hammerbeck and Hooper 2012).

Ограничения в отношении использования проточной цитометрии с клетками хомячка заключаются в том, что доступно только очень небольшое количество антител, при этом многие антитела, разработанные для использования с клетками мыши и крысы, не обладают перекрестной реактивностью. Другая проблема заключается в том, что каждый конкретный клон должен быть протестирован для подтверждения перекрестной реактивности с клетками хомяка, поскольку клоны, созданные разными компаниями, могут не в каждом случае реагировать с одинаковой специфичностью с клетками хомячка. Кроме того, несколько доступных антител, которые перекрестно реагируют, ограничиваются белками клеточной поверхности на Т- и В-клетках. Это приводит к невозможности определить статус активации, подмножество клеток или идентифицировать другие не-Т- и В-клетки, такие как макрофаги, дендритные клетки, нейтрофилы и NK-клетки. Как и в случае анализов ELISA и ELISPOT у хомяков, отсутствие антител против специфичных для хомяков цитокинов не позволяет использовать проточную цитометрию для обнаружения клеток, продуцирующих цитокины, путем внутриклеточного окрашивания для фенотипирования иммунного ответа.Это является основным ограничением использования проточной цитометрии в моделях хомяков. Наконец, использование антител против мышиного CD4 и крысиного CD8β для применения у хомяков должно осуществляться в сочетании с антителами против мышиного/крысиного MHC II, чтобы исключить клетки миелоидного происхождения, экспрессирующие либо CD4, либо CD8β, что показало так было у мышей (Hammerbeck and Hooper 2012). К счастью, было показано, что комбинация этих антител эффективна для идентификации CD4 и CD8 Т-клеток у хомяков из-за отсутствия связывания клеток как против мышиного CD4 или против крысиного CD8β, так и против мышиного/крысиного MHC II (Hammerbeck). и Хупер 2012).В целом, использование проточной цитометрии у хомяков сильно ограничено из-за отсутствия специфических для хомяков антител. Идентификация и возможная сортировка В-клеток и Т-клеток CD4 и CD8 возможны из-за перекрестной реактивности антимышиных и антикрысиных антител, но должны проводиться с осторожностью и оптимизацией протоколов отдельными исследователями для определения перекрестной реактивности. уровни конкретных клонов.

Что касается использования моноклональных антител против маркеров клеточной поверхности мыши и крысы, способных перекрестно реагировать с белками хомячка, для использования в проточной цитометрии, было показано, что эти антитела эффективны при истощении Т-клеток CD4 и CD8 in vivo у хомяков (Prescott et al. 2013, 2015; Хаммербек и Хупер, 2012). Способность этих антител распознавать Т-клетки хомяка и опосредовать истощение in vivo позволяет проводить исследования истощения и определять важность Т-клеток CD4 или CD8 в моделях инфекционных заболеваний. Способность перекрестно-реактивных антител истощать Т-клетки in vivo является значительным преимуществом при изучении иммунных ответов хозяина на моделях заболеваний. Учитывая ограниченную возможность оценки определенных иммунных параметров ex vivo у хомяков, это обеспечивает критически важный инструмент для иммунологических исследований у хомяков.Для использования этих антител для истощения клеток in vivo существуют те же предостережения, что и для их использования в проточной цитометрии, но это дает исследователям интересный путь для оценки иммунного ответа против определенных патогенов или тестирования эффективности лекарств и вакцин.

2.4 Иммуногистохимия

Иммуногистохимия десятилетиями была мощным методом обнаружения специфических антигенов в фиксированных формалином тканях (Schacht and Kern 2015). С момента появления гибридом для производства моноклональных антител в 1975 году иммуногистохимия приняла использование моноклональных антител для обнаружения специфических антигенов с высокой специфичностью (Schacht and Kern 2015; Köhler and Milstein 1975). Использование специфических антител позволяет обнаруживать в фиксированных тканях бактерии, вирусы, определенные типы клеток, такие как лимфоциты, и клеточные маркеры патологии заболевания. В то время как иммуногистохимия имеет важное применение в диагностике, на животных моделях заболеваний она особенно полезна для оценки патологии в пораженных тканях и может обнаруживать присутствие проникающих в ткани иммунных клеток, которые могут вызывать иммунопатогенез в ходе болезни.

Иммуногистохимия у хомяков для оценки патологии болезни была популярной методикой из-за отсутствия реагентов, доступных для классических иммунологических методов. Он использовался для изучения течения многих моделей инфекционных заболеваний, включая вирус Анд, вирус Син Номбре, вирус Чикунгунья, вирус Нипах и вирус Эбола (Safronetz et al. 2013; DeBuysscher et al. 2013; Ebihara et al. 2012). ; Сафронетц и др., 2011b; Боско-Лаут и др., 2015). Он также полезен в моделях неинфекционных заболеваний у хомяков, таких как рак и энцефалопатические заболевания (Woods et al.2015 г.; Клаус и др. 2015 г.; Элдер и др. 2013). Хотя использование этого метода у хомяков обычно ограничивается исследованием сохранившихся тканей, демонстрирующих патологическую патологию, преимущества заключаются в том, что можно визуализировать поперечные срезы целых тканей, чтобы получить более репрезентативное изображение тропизма болезни и присутствия иммунных клеток или конкретных клеток. патогены могут быть легко обнаружены (Schacht and Kern 2015). Как и в случае других иммунологических методов у хомяков, обнаружение большинства иммунных клеток ограничивается наличием нескольких перекрестно-реактивных антител, а антитела против общих маркеров клеточной поверхности, обнаруженные во многих тканях, недоступны или их перекрестной реактивностью с антителами против этих маркеров в других тканях. виды не оценены.Другие неотъемлемые ограничения иммуногистохимии включают изменение антигенов в процессе фиксации, относительную нечувствительность анализа по сравнению с другими методами, такими как ИФА и ПЦР, а также технические требования, связанные с процедурой (Schacht and Kern 2015). В частности, в случае патогенов, требующих высокой степени изоляции, процедура фиксации тканей может длиться до нескольких недель, что увеличивает вероятность изменения тканей, когда наилучшие результаты достигаются как можно скорее после эвтаназии.Несмотря на эти проблемы, ценность использования иммуногистохимии на моделях хомяков заключается в возможности исследовать несколько тканей, пораженных в ходе болезни, определять специфический тканевой тропизм патогенов путем визуализации патогенов в инфицированных тканях и изучать возможную инфильтрацию иммунных клеток в ткани, которые могут способствовать иммунопатогенезу при некоторых заболеваниях.

2.5 Анализ транскриптома/микрочипа

В последние годы секвенирование и анализ транскриптома использовались для получения наборов мРНК, которые экспрессируются у данных видов, помогают получить представление о профилях экспрессии этих видов, а также для разработки микрочипов для обнаружения экспрессии генов (Читчек и др. 2014; Ин и др. 2015). Описание транскриптома мышей, крыс и людей имело решающее значение для более широкого использования микрочипов для изучения профилей экспрессии в тканях во многих моделях (Yu et al., 2009; Okazaki et al., 2002; Yang et al., 2010; Maywood). и др., 2009). В последнее время секвенирование и анализ транскриптома хомяков было выполнено в нескольких моделях (Ying et al. 2015; Yu et al. 2009; Yang et al. 2010; Maywood et al. 2009; Hohlweg et al. 2003; Schmucki et al. 2013). . В последние годы использование микрочипового анализа у хомяков было ограничено перекрестно-реактивной гибридизацией РНК хомяка с кДНК других видов, таких как крысы, мыши и люди (Yu et al.2009 г.; Валь-Дженсен и др. 2012). кДНК, содержащие транскриптом хомяка, были выровнены по последовательности с транскриптомом видов, которые были описаны ранее (Tchitchek et al. 2014). Это секвенирование транскриптома позволило идентифицировать большой набор генов, которые играют роль в ряде биологических процессов. Впоследствии Ying et al. смогли секвенировать и аннотировать более 34 000 последовательностей, содержащих транскриптом хомяка, для разработки специального микрочипа хомяка (Ying et al.2015). Микрочип, который был разработан на основе транскриптома хомяка, был подтвержден путем сравнения профилей экспрессии генов у мышей, инфицированных аденовирусом, с использованием пользовательского микрочипа и qRT-PCR (Ying et al. 2015). Это было одно из первых описаний микрочипа, специфичного для хомяков, способного обнаруживать изменения в экспрессии генов хомяков. Мы надеемся, что этот недавно разработанный микрочип после секвенирования и аннотации транскриптома хомяка приведет к созданию более специфичных для хомяка микрочипов.В то время как РНК-секвенирование недавно использовалось для изучения регуляции генов у хомяков в модели аренавирусной инфекции (Schountz et al. 2015), использование РНК-секвенирования еще не стало обычным явлением в моделях инфекционных заболеваний хомяков. Вполне вероятно, что использование секвенирования РНК станет более популярным в ближайшие годы, поскольку геном и транскриптом хомяков станут полностью охарактеризованными и общедоступными, описание транскриптома хомяка и его значение для разработки микрочипов, специфичных для хомяков, не должно упущен из виду. Мы надеемся, что эта недавняя работа над транскриптомом хомяка приведет к созданию полезных инструментов, таких как микрочипы, для исследователей, которые хотят использовать хомяков в качестве животной модели болезни.

2.6 Киномный анализ

Исторически способность оценивать реакцию хозяина на патогены основывалась на изучении экспрессии генов или синтеза белка в форме антител или цитокинов. Поскольку многие внутриклеточные пути, участвующие в передаче сигналов иммунными клетками, хорошо известны, и многие белки были охарактеризованы, белки, передающие сигналы клеток внутри клеток-хозяев, в последнее время стали мишенью для терапевтических средств.Способность киназ фосфорилировать белки имеет решающее значение для клеточной передачи сигналов и позволяет быстро реагировать на стимулы окружающей среды, такие как стресс или инфекция (Arsenault et al. 2011; Falcinelli et al. 2015). Только недавно был реализован потенциал изучения присутствия киназ, участвующих в передаче сигналов клетками, которые в совокупности называются киномами. Изучение киназ, участвующих в передаче иммунных сигналов, может дать важные индикаторы исхода заболевания на определенных моделях (Falcinelli et al.2015). Киномный анализ включает синтез пептидов, представляющих сайты фосфорилирования на сотнях белков, иммобилизованных на поверхности массива (Arsenault et al. 2011). Образцы, содержащие клеточные киназы, фосфорилируют иммобилизованные пептиды, которые затем можно визуализировать для определения уровня относительного фосфорилирования и активности киназ в образце (Arsenault et al. 2011). Изучение кинома во время ответа хозяина на патогены использовалось в качестве инструмента для определения клеточных ответов и оценки иммунных ответов хозяина в различных моделях заболеваний (Kindrachuk et al.2012, 2014; Арсено и др. 2013; Киндрачук и Наппер, 2013).

Falcinelli et al. недавно синтезировали массив киномных пептидов у хомяков. в модели аренавирусной инфекции (Falcinelli et al. 2015). Этот специфичный для хомяков кином был разработан с использованием пептидов, направленных в первую очередь на иммунные пути, и показал, что аренавирусная инфекция у хомяков характеризуется реакцией фактора роста эндотелия сосудов легких и интерлейкина, а также сигналами NF-kB и TLR (Falcinelli et al. 2015). Это представляет собой новый анализ для оценки специфических иммунных ответов хомяков на инфекцию путем изучения уровня активности киназ клеток-хозяев.

2.7 Генетические манипуляции

Способность генетически манипулировать животными для использования в исследованиях была бесценной на протяжении десятилетий в бесчисленных моделях заболеваний. С момента первого описания генетически модифицированных мышей в конце 1980-х годов Мартином Эвансом, Оливером Смитисом и Марио Капечки, что привело к получению Нобелевской премии по физиологии и медицине, использование генетически модифицированных животных произвело революцию в биомедицинских исследованиях (Manis 2007; Thomas and Capecchi 1987; Capecchi 2005).Для иммунологов использование нокаутных и трансгенных мышей было важно для определения роли типов клеток, цитокинов и факторов транскрипции, а также для получения ценных сведений о таких вещах, как иммунная память и регуляция (Manis 2007). Генетически модифицированные мыши стали настолько распространены, что коммерчески доступные трансгенные мыши и мыши с нокаутом десятков генов легко доступны.

До недавнего времени нацеливание генов у хомяков было ограничено из-за отсутствия полностью секвенированного генома.Однако Фан и соавт. сообщили о системе CRISPR/Cas9 для нацеливания на специфические гены хомяков (Fan et al. 2014). Им удалось успешно воздействовать на ген STAT2 хомяков с надежной эффективностью, чтобы получить хомяков с нокаутом STAT2 (Fan et al. 2014). Этих хомяков впоследствии использовали другие в модели аденовируса, чтобы показать, что ответы IFN типа I имеют решающее значение для борьбы с аденовирусной инфекцией (Toth et al. 2015). Это первые исследования, в которых сообщается и используются генетически модифицированные хомяки.Эти результаты показывают потенциал не только использования хомяков с нокаутом STAT2 в изучении моделей заболеваний, но также потенциал для нокаута других генов, играющих важную роль в иммунных путях. Мы надеемся, что эти исследования послужат первым шагом в разработке большего количества нокаутных и возможных трансгенных хомяков для использования в качестве моделей инфекционных заболеваний.

Хомячки — хорошие домашние животные благодаря своему небольшому размеру, простоте ухода и хорошей управляемости. Большинство домашних хомяков дружелюбны и любопытны.Золотистый или сирийский хомяк — самый распространенный домашний питомец. Другие виды, которые можно найти в зоомагазинах, включают сибирского или карликового хомяка и китайского хомяка. Хомяки ведут ночной образ жизни, то есть они наиболее активны ночью и в вечерние часы.

Самцы хомяков становятся лучшими домашними животными, потому что они менее агрессивны. Крупные виды хомяков, как правило, менее агрессивны и с ними легче обращаться. Хомяков следует содержать в клетке поодиночке и не размещать вместе из-за проблем с драками и агрессией.Хомяки весят около 80-150 граммов в зависимости от вида. Хомяки живут в среднем 1-3 года.

Знакомство с новым хомячком

Когда вы впервые приобретаете нового хомяка в качестве домашнего животного, с ним нужно обращаться аккуратно и двигаться в темпе, удобном для вашего хомяка. Слишком много прикосновений слишком рано (до того, как ваш хомяк узнает вас) может вызвать стресс. Лучше всего заниматься в вечерние часы, потому что именно тогда ваш хомяк будет наиболее активен. Хомяки могут быть резкими при первом пробуждении или при резких движениях, поэтому делайте это медленно.

Лучший способ взять хомяка на руки — осторожно взять его в руки или аккуратно взять, положив руку ему на спину. Поскольку они маленькие и быстрые, брать их с собой маленькими детьми может быть опасно для хомяка, и это не рекомендуется. Лакомство можно использовать в качестве положительного подкрепления, чтобы ваш хомяк привык к тому, что его берут на руки.

Корпус

Безопасная, хорошо проветриваемая клетка необходима для здоровья вашего хомяка. Клетки должны быть не менее 12 дюймов в высоту, и на каждого хомяка в вольере должно приходиться около 25 квадратных дюймов площади пола, но общее правило — чем больше, тем лучше! Клетки с несколькими уровнями позволяют хомякам исследовать и тренироваться. Пластиковые, из нержавеющей стали или стеклянные клетки более распространены. Можно использовать клетки аквариумного типа, но они не должны быть первым выбором, потому что существует риск плохой вентиляции и проблем с дыханием, если их не содержать в безупречной чистоте. Пол должен быть твердым, чтобы избежать травм пальцев ног и подушечек стоп.

Если стенки клетки выполнены из проволочной сетки, важно убедиться, что размер сетки достаточно мал, чтобы пальцы ног и ноги не застревали в квадратах сетки. Хомяки печально известны тем, что убегают из клеток, и это может причинить вред, если они беспризорничают в доме с собаками или кошками или получают доступ к электрическим проводам.У хомяков в клетке должно быть несколько мест, где они могут спрятаться и исследовать; ящики для укрытий, туннели для лазанья, трубы из ПВХ и другие коммерческие игрушки — все это отличные варианты. Хомякам также нравится беговое колесо. Просто убедитесь, что колесо имеет твердую поверхность, а не открытые квадраты, потому что пальцы ног могут зацепиться за квадраты и привести к травмам. Мячи для хомяков можно использовать для упражнений с хомячком вне клетки, но внимательно следите за своим хомячком во время этих упражнений. Мячи для упражнений могут скатиться вниз по лестнице, их могут погрызть другие домашние животные и они могут перегреться под прямыми солнечными лучами.

Подложка

Мы рекомендуем использовать только переработанные газеты или бумажные изделия, такие как подстилка Carefresh, в клетке вашего хомяка. Натуральные подстилки (кедр, сосна, осина, древесная стружка или стружка) склонны к размножению микроорганизмов, таких как бактерии и грибки, даже при надлежащей и частой очистке. Они также могут создавать пыль, которая может вызвать аллергию как у хомяков, так и у их людей. Респираторные заболевания распространены у хомяков, и те, которые содержатся на естественных подстилках, подвергаются повышенному риску возникновения проблем.

Питание

Хомяков следует кормить имеющимся в продаже гранулированным кормом или блоком для грызунов. Идеальные продукты питания включают гранулы Oxbow или Kaytee. Не покупайте пакеты со смесью семян и гранул – хомяки просто съедят все семена и оставят более здоровую пищу позади! Гранулы могут быть предложены на выбор (обычно предпочтительнее керамическая посуда, потому что она тяжелее и не будет так легко высыпаться, или воронка для кормления также является отличным выбором).

Угощения должны быть ограничены и могут включать в себя некоторые свежие овощи, редкие семена и орехи или сухофрукты, такие как изюм.У хомяков есть защечные мешки, в которых они могут хранить еду, поэтому вы нередко видите, как ваш хомяк набивает морду едой и уходит в свое убежище, чтобы закончить ужин! Вода всегда должна быть доступна для ваших хомяков и должна предлагаться из поилки в клетке. Свежую воду следует давать каждый день. Обязательно регулярно тщательно мойте бутылку с водой и посуду для еды, чтобы избежать накопления бактерий. Для мытья посуды можно использовать горячую воду и средство для мытья посуды; просто убедитесь, и промойте их тщательно.

Медицинское обслуживание

Новорожденных домашних хомяков следует осматривать в течение первой недели на наличие любых признаков болезни и кишечных паразитов. В целях безопасности возьмите хомяка в переноску или дорожную клетку. Обследования следует проводить два раза в год, чтобы убедиться, что ваш хомяк здоров. Профилактическая стерилизация и стерилизация помогают не только предотвратить определенные заболевания, но и увеличить продолжительность жизни. Знание распространенных заболеваний хомяков и признаков, на которые следует обращать внимание, поможет вам понять, нужно ли вам привести хомяка на обследование.

Экзотические питомцы склонны скрывать признаки болезни до тех пор, пока они не перестанут выглядеть нормальными. Это потому, что они животные-жертвы, и их инстинкты говорят им, что для выживания они должны выглядеть счастливыми и здоровыми, иначе они станут мишенью хищников. К несчастью для нас, это означает, что обычно, когда мы впервые замечаем, что наши домашние хомячки больны, на самом деле они болеют уже несколько дней, если не недель. Обычно вы не можете позволить себе роскошь «подождать и посмотреть», чтобы увидеть, поправится ли ваш хомячок без лечения.Своевременная медицинская помощь жизненно важна для помощи вашему хомячку! К счастью, хомяки довольно выносливы и устойчивы ко многим заболеваниям, но все же могут заболеть.

Вот некоторые распространенные заболевания хомяков и признаки, на которые следует обратить внимание у ваших питомцев:

Энтерит/пролиферативный илеит (также называемый «влажным хвостом»)

Диарею у хомяков необходимо лечить как можно быстрее, потому что они могут быстро терять жидкость и вес. Признаки включают жидкий стул, который больше не имеет гранулированной формы, снижение аппетита и вялость.Для лечения диареи необходимы соответствующие противомикробные препараты. Обычно имеет инфекционную или паразитарную природу.

Респираторные заболевания/пневмония

Хомячки могут быть подвержены респираторным заболеваниям и инфекциям, особенно те, которые находятся в состоянии стресса (скованность, драки в клетке, другие заболевания и т. д.), а также те, которые содержатся на натуральных подстилках в качестве субстрата. Признаки, на которые следует обратить внимание, включают чихание, учащенное дыхание, щелчки при дыхании, вялость и потерю аппетита.Антибиотики необходимы для устранения любой инфекции.

Вдавленные защечные мешки

Иногда глаза хомяка слишком велики для его живота… или его защечных мешков. Если вы заметили неприятный запах или выделения изо рта, а также припухлость на одной или обеих сторонах лица, это может указывать на защемление защечного мешка, требующее лечения.

Сердечно-сосудистые заболевания С возрастом хомяки склонны к развитию сердечно-сосудистых заболеваний. Признаки включают учащенное дыхание, слабость, снижение аппетита, щелкающие звуки при дыхании и коллапс.Лечение можно назначать при сердечных заболеваниях и застойной сердечной недостаточности, но сердечные заболевания неизлечимы.

Выпадение волос

Наиболее распространенными причинами выпадения шерсти у молодых хомяков являются неинфекционная чесотка (Demodex mange), стригущий лишай, стресс и поверхностные бактериальные инфекции. У пожилых хомяков чаще встречаются эндокринные заболевания, связанные с надпочечниками, и выпадение шерсти, вызванное чрезмерным уходом за шерстью, вторичное по отношению к раку брюшной полости.

Дефицит витамина Е У хомяков, которых кормят преимущественно кормом на основе семян, может развиться дефицит витамина Е, что может вызвать слабость, потерю аппетита и паралич задних конечностей.

Переросшие резцы

Резцы постоянно растут и могут зарасти или вырасти в неправильном положении. В этот момент необходимо провести корректирующую обрезку ветеринаром, когда эти зубы зарастают, и лечение обычно должно продолжаться всю жизнь.

Минимальный 30-дневный карантинный период рекомендуется для любого нового домашнего животного, привезенного в дом с существующими экзотическими домашними животными. Это делается для защиты предыдущих питомцев владельца от любых новых болезней или паразитов, которые могут быть переносчиками нового питомца.Симптомы большинства инфекционных заболеваний проявляются в течение этого 30-дневного периода. Домашние животные, находящиеся на карантине, по возможности должны содержаться в отдельной комнате и иметь отдельные миски для еды и воды в течение всего периода карантина. Сначала займитесь своими предыдущими питомцами, затем займитесь новым питомцем. После того, как период карантина закончился, и у вашего нового питомца не было никаких признаков болезни и он был осмотрен ветеринаром, ваши предыдущие питомцы должны быть в безопасности от большинства инфекционных заболеваний.

Распространенные причины и симптомы заболеваний хомяков

Хомяки — обычные домашние животные.Они живут в среднем 2 года, но продолжительность их жизни может варьироваться. Хомяки будут скрывать свою болезнь до тех пор, пока они не станут очень больными и не начнут проявлять более очевидные признаки болезни, такие как вялость, аномальное дыхание, заметная потеря веса, грубая или плохая шерсть и пониженная температура тела. Очень важно каждый день взаимодействовать с хомячком, оценивать его потребление пищи, проверять наличие закопанных запасов пищи и следить за потреблением воды, чтобы как можно скорее предупредить вас о болезни и болезнях. Продолжайте читать, чтобы узнать о наиболее распространенных заболеваниях хомяков и симптомах, на которые следует обратить внимание.

Вы беспокоитесь о своем питомце?

Запишитесь на видеоконсультацию с опытным ветеринаром за считанные минуты.

  • Профессиональные ветеринарные консультации онлайн
  • Недорогие видео консультации ветеринара
  • Открыто 24 часа в сутки, 365 дней в году Lawsonia intracellularis, вызывающая тяжелую диарею.Диарея может быстро привести к опасному для жизни обезвоживанию и электролитным нарушениям.

    Диагноз можно поставить на основании клинических симптомов, возраста хомяка и ПЦР-теста кала. Лечение включает антибиотики, жидкую поддержку и вспомогательное питание, чтобы помочь им восстановиться. В тяжелых случаях у хомяка может выпасть ректальная ткань, кишечник может свернуться или стать непроходимым. Часто это фатальные состояния, если их не лечить немедленно.

    У взрослых хомяков часто причиной является другая бактерия, Clostridium piliforme. Это также называется болезнью Тиззера. Это часто наблюдается у хомяков, которые находятся в состоянии стресса, переполнены, плохо питаются, содержатся при слишком высоких температурах и из зоомагазинов.

    Кишечные паразиты, такие как лямблии и кокцидии, являются еще одной распространенной причиной диареи у хомяков.

    Лечение будет зависеть от основной причины диареи.

    Рак может поражать хомяков

    Хомяки склонны к развитию рака. Сирийские хомяки подвержены более высокому риску развития меланомы, формы рака кожи.Часто это новообразования кожи темного цвета, которые в 10 раз чаще встречаются у мужчин, чем у женщин.

    Джунгарские хомяки в 5 раз чаще болеют раком по сравнению с сирийскими хомяками. Опухоли молочной железы (рак молочной железы) и опухоли кожи, такие как папилломы и фибромы, являются наиболее распространенными формами рака.

    Лимфома — наиболее распространенный вид рака у хомяков. Он может поражать лейкоциты, лимфатические узлы, кожу, печень и селезенку. Симптомы включают увеличение лимфатических узлов, вялость, снижение аппетита, потерю веса и пятнистую шерсть.

    Респираторные инфекции

    У хомяков может развиться бактериальная пневмония, и они могут быть инфицированы человеком! Симптомы включают аномальное дыхание, учащенное дыхание, выделения из глаз или носа и вялость. Окрашивание выделений из носа и глаз может помочь выявить бактерии. Лечение включает антибиотик и поддерживающую терапию.

    Старайтесь не прикасаться к хомяку во время простуды, чтобы снизить риск его заражения.

    Заболевания сердца

    У хомяков могут образовываться тромбы в сердце в результате сердечной недостаточности.Это, как правило, поражает самок хомяков в более молодом возрасте, чем самцов, около 1 года у самок и почти 2 года у самцов.

    Симптомы включают учащение дыхания, учащение пульса и посинение кожи, десен и языка. Если не лечить, большинство хомяков умирают в течение недели после появления симптомов. Лекарства от сердечной недостаточности не существует, но можно давать лекарства, которые помогают уменьшить общий объем жидкости в организме и уменьшить объем работы, которую должно выполнять сердце.

    Увеличение сердца, называемое кардиомиопатией, может наблюдаться у хомяков старше полутора лет. Клинические симптомы включают учащение дыхания, похолодание конечностей (лап), вялость и снижение аппетита. Диагноз можно поставить на основании клинических симптомов, рентгенограммы грудной клетки для оценки размера и формы сердца и, возможно, УЗИ сердца (эхокардиограмма). Поддерживающие препараты для сердца также можно использовать для уменьшения нагрузки на сердце, но это не лечится.

    Распространенные кожные заболевания у хомяков

    У хомяков могут развиться абсцессы под кожей, часто в результате предыдущей драки или укушенных ран.Абсцесс развивается под кожей после заживления первоначальной раны и может ощущаться как жидкость или твердая шишка под кожей. Лечение может включать антибиотики, вскрытие и промывание абсцесса, а также обезболивание.

    Хомяки также могут заразиться кожными инфекциями от чесоточного клеща Demodex. Это другие клещи демодекс, чем собаки и кошки. Выпадение волос и отсутствие зуда кожи являются общими симптомами. Ваш ветеринар может выполнить соскоб кожи, чтобы найти клещей и начать лечение.

    Стригущий лишай, грибковая инфекция, также может поражать хомяков.Частыми симптомами являются участки выпадения волос и корки на коже. Ваш ветеринар может выполнить культуру грибка, чтобы подтвердить, что стригущий лишай является причиной поражений кожи, и начать лечение, которое может состоять из пероральных противогрибковых препаратов, лечебных шампуней или растворов.

    Подробнее:

    Советы по стрижке когтей кроликам и другим домашним животным

    Распространенные болезни кроликов и их симптомы

    Содержание и содержание хорьков

    Вам нужно поговорить с ветеринаром по поводу болезни вашего хомяка или другого заболевания?

    Нажмите здесь, чтобы запланировать видеоконсультацию, чтобы поговорить с одним из наших ветеринаров.Вы также можете загрузить приложение FirstVet из магазинов Apple App Store и Google Play.

    Нужен ли моему хомячку ветеринар?

    Хомяки могут быть маленькими, но они полны характера и часто становятся важными членами семьи, несмотря на их относительно короткую продолжительность жизни. Как естественно ночная добыча, они могут быть скрытными, когда дело доходит до проявления признаков болезни или слабости. Это может затруднить поиск тонких признаков, которые могут свидетельствовать о том, что ваш хомяк плохо себя чувствует.Так как же узнать, когда вашему хомяку нужно обратиться к ветеринару?

    Общие признаки, которые могут свидетельствовать о том, что ваш хомяк плохо себя чувствует, включают: 

    • сниженная активность, например, пребывание на одном и том же месте в течение длительного времени
    • сидение в сгорбленном положении с закрытыми глазами
    • употребление меньшего количества пищи
    • более быстрое или тяжелое дыхание, чем обычно.

    Некоторые проблемы вызывают более специфические симптомы и признаки, которые могут помочь нам лучше понять, в чем может быть дело.

    Регулярное наблюдение за хомяком и обращение с ним помогут вам выявить признаки болезни как можно раньше. Вот несколько наиболее распространенных причин, по которым хомякам необходимо обратиться к ветеринару, и на что следует обратить внимание в домашних условиях.

    Диарея

    Диарея, иногда называемая «влажным хвостом», может быть связана с диетой, проблемами с кишечником, такими как вирусная или бактериальная инфекция, или вторичным по отношению к другому заболеванию. Лечение некоторыми антибиотиками также может привести к диарее.

    Кормление различными продуктами, особенно чрезмерным количеством свежих овощей, может привести к тому, что помет станет мягким. Если ваш хомячок хорошо ест, активен и бодр, но у него мягкий или жидкий помет, попробуйте воздержаться от свежих овощей на день или два, чтобы посмотреть, поможет ли это. Тем не менее, хомяка, который плохо себя чувствует, мало ест или ведет себя тихо, а также у него диарея, следует немедленно показать ветеринару, так как болезнь может быстро прогрессировать. Тяжелая диарея может привести к обезвоживанию, потере веса или выпадению прямой кишки и может быть опасной для жизни, если ее не лечить.

    Истинный «влажный хвост» вызывается бактерией под названием Lawsonia intracellularis , которая вызывает сильную диарею у молодых хомячков в период отлучения от груди. Это очень заразно и часто со смертельным исходом. Тем не менее, многие ветеринары называют диарею «мокрым хвостом» независимо от причины.

    Чихание, насморк и проблемы с дыханием

    Респираторные заболевания — еще одна частая причина обращения хомяков к ветеринару. Признаки включают чихание, выделения из глаз и носа, отек век и учащение дыхания или усилие.Хомяки с проблемами дыхания часто кажутся в целом нездоровыми и могут быть сгорбленными, тихими в себе и без еды. Если у вашего хомяка проявляются эти симптомы, важно как можно скорее показать его ветеринару. Хомяки могут очень быстро серьезно заболеть, особенно если их проблемы с дыханием связаны с легочной инфекцией.

    Легкие признаки заболевания верхних дыхательных путей, могут быть связаны с раздражением. Это периодическое чихание, слегка влажный нос или слегка опухшие веки.Если в остальном ваш хомяк чувствует себя хорошо, постарайтесь избегать потенциальных раздражителей, таких как освежители воздуха, сигаретный дым или пыльная подстилка, чтобы посмотреть, поможет ли это. Важно регулярно чистить постельное белье, чтобы предотвратить накопление паров аммиака из мочи. Это может вызвать раздражение глаз и носа. В этом также помогает убедиться, что вольер достаточно теплый и хорошо проветриваемый, но без сквозняков. Однако, если у вашего питомца появляются другие симптомы или ему кажется, что он плохо себя чувствует, безопаснее всего показать его ветеринару.

    Кожные заболевания

    Проблемы с кожей часто встречаются у хомяков, проявляясь такими симптомами, как зуд, выпадение шерсти, струпья или язвы. Заболевание кожи, как правило, легче заметить, чем другие формы болезни. Признаки хорошо видны во время контакта с хомячком или при наблюдении за ним. Общие причины включают внешних паразитов, таких как клещи, грибковые инфекции, такие как стригущий лишай, и физические травмы от других хомяков, включая укушенные раны или обгрызание шерсти, известное как «стрижка». Стригущий лишай может передаваться человеку, поэтому будьте осторожны при обращении с хомяками с кожными заболеваниями.

    Если вы видели, как другой хомяк обгрызает шерсть вашего хомяка, и на коже нет повреждений, вы можете попробовать разделить двух хомяков. В качестве альтернативы, попробуйте предоставить им более просторный вольер с большим количеством укрытий, чтобы у каждого из них было свое личное пространство. Если причина проблемы с кожей не ясна, важно показать хомяка ветеринару для диагностики. Лечение сильно различается в зависимости от причины проблемы, и многие кожные заболевания могут выглядеть одинаково.

    В редких случаях проблемы с кожей могут иметь более зловещую причину, например некоторые виды рака.

    Также важно знать, что у хомяков есть ароматические железы, которые представляют собой круглые или овальные участки утолщенной кожи, которые могут быть жирными. У сирийских хомяков по одной на каждом боку, тогда как у карликовых хомячков есть одна запаховая железа на нижней стороне. Это нормальные признаки, но они могут воспаляться, инфицироваться, покрываться восковым налетом или даже раком.

    Болезнь защечного мешка

    Для хомяков нормально собирать и хранить пищу в защечных мешках, часто перенося ее в свою спальную зону, чтобы оставить на потом.Некоторые хомяки пытаются запихнуть в свои сумки большие куски еды, на что может быть довольно комично смотреть. Однако защечные мешки также могут вызвать некоторые проблемы.

    Пища может попасть в мешок, вызывая воспаление и инфекцию, в некоторых случаях приводя к абсцессу. Седация или анестезия часто требуется для удаления ретинированного материала и очистки мешка.

    Защечные мешки также могут выпадать. Это существенно означает, что мешочек выворачивается наизнанку, выступая изнутри щеки и изо рта.Иногда мешок можно легко заменить, если выпадение произошло совсем недавно. Однако иногда вывернутый мешок повреждается, что требует хирургического вмешательства. В любом случае, проблемой должен заниматься ветеринар, так как ткань сумки нежная и легко повреждается. Мешочки, которые снова выпадают после замены, также выигрывают от хирургического вмешательства, чтобы навсегда заменить мешочек с помощью шва.

    Проблемы с защечным мешком могут быть связаны с проблемами зубов, что является еще одной хорошей причиной, чтобы попросить вашего ветеринара осмотреть вашего хомяка.

    Вздутие живота

    Вздутие живота может наблюдаться при ряде заболеваний. Регулярное обращение с хомячком облегчает замечание небольших изменений формы или размера его тела. Однако значительное вздутие живота можно увидеть, просто понаблюдав за хомячком, особенно если он не очень пушистый.

    Вздутие живота может быть вызвано опухолями, кистами или жидкостью в брюшной полости. Кисты на печени не редкость, а жидкость может скапливаться в результате болезни сердца. Ваш ветеринар может определить вероятную причину, осмотрев вашего хомяка, или может предложить исследования, такие как сканирование брюшной полости. Вздутие живота обычно указывает на серьезное заболевание, часто с неблагоприятным прогнозом.
    Регулярное обращение с хомячком и общение с ним, а также знакомство с его привычками помогут вам заметить любые изменения, которые предполагают, что он не чувствует себя. Если вы заметили что-то необычное для своего питомца или какие-либо из упомянутых выше признаков, лучше всего показать хомяка ветеринару, чтобы он проверил его и назначил лечение, которое может ему понадобиться.

    Исследование Omicron SARS-CoV-2 на хомяках показывает, что вирус приводит к менее тяжелому заболеванию

    В недавнем исследовании, опубликованном на сервере препринтов bioRxiv* , исследователи изучают способность иммунитета, полученного от прототипа коронавирусной болезни, связанной с тяжелым острым респираторным синдромом (SARS-CoV-2), защищать от коронавирусной болезни (COVID-19). ), вызванный вариантом Омикрон в моделях сирийских хомяков.

    Исследование: выздоровление от прототипа SARS-CoV-2 защищает сирийских хомяков от болезни, вызванной вариантом Omicron.Изображение предоставлено: Orpheus FX / Shutterstock.com

    Значение варианта Омикрон

    В ноябре 2021 года вариант SARS-CoV-2 Omicron (B.1.1.529) был определен Всемирной организацией здравоохранения (ВОЗ) как вариант, вызывающий озабоченность (VOC). Во многом это произошло из-за многочисленных мутаций в области белка шипа (S) Omicron, многие из которых, как ранее было обнаружено, снижают иммунитет как от вакцины, так и от предыдущего связанного с COVID-19 иммунитета.

    Для доклинических исследований терапевтических средств и вакцин, связанных с COVID-19, были быстро разработаны различные модели животных.В результате модель золотого сирийского хомяка стала общепризнанной. Он демонстрирует клинические симптомы тяжелого заболевания COVID-19 по сравнению с моделями хорьков и нечеловеческих приматов, представляющими бессимптомное и легкое заболевание. Кроме того, модели сирийских хомяков могут эффективно определять эффективность терапевтических вмешательств, а также могут использоваться для исследований перекрестной защиты после соответствующей оптимизации.

    Об исследовании

    В настоящем исследовании vivo , проведенном на моделях сирийских хомяков, патогенность и защита, связанные с иммунитетом выздоравливающих от штамма 99.Определено 99% сходства со штаммом дикого типа SARS-CoV-2 по отношению к варианту Омикрон.

    Помимо варианта B.1.1.529, выделенного Агентством по безопасности здравоохранения Соединенного Королевства (UKHSA), прототип варианта SARS-CoV-2 Australia/VIC01/2020, выделенный в январе 2020 года, предоставленный Институтом Доэрти, Австралия, использовался в изучать. Эксперимент по снижению дозы с более низкими дозами штаммов SARS-CoV-2 с гомологичной реинфекцией в оптимизированный момент времени у хомяков был проведен для определения влияния инфекции, ослабления иммунитета с течением времени и перекрестной защиты от варианта Omicron.

    Хомяков инфицировали интраназально четырьмя различными титрами варианта SARS-CoV-2 Australia/VIC01/2020 (VIC01) для достижения целевых доз. Через 50 дней после первоначального заражения VIC01 трем хомячкам из каждой выздоравливающей группы повторно вводили либо Omicron, либо варианты VIC01, в результате чего было получено 12 хомяков, повторно зараженных VIC01 и Omicron, соответственно.

    В исследовании участвовали две контрольные группы хомячков, не подвергавшихся лечению, и примерно шесть и 11 хомяков в этих контрольных группах были инфицированы VIC01 и Omicron соответственно.

    Обратное титрование инфицированных животных с помощью анализа формирования очагов (FFA) гарантировало, что контрольной и повторно инфицированной группам вводили сопоставимые дозы вариантов Omicron и VIC01. Кроме того, у хомячков оценивали продольный гуморальный иммунитет на 20-й и 41-й день после заражения.

    Результаты исследования

    Эксперименты продемонстрировали высокие титры нейтрализующих антител на 20-й и 41-й день после заражения, независимо от дозы вариантов, введенных хомякам. Точно так же повторное введение, проведенное через 50 дней после заражения, показало высокий уровень циркулирующих антител. Однако группы хомяков, которые получили целевую дозу VIC01 5E+02, имели более низкие циркулирующие нейтрализующие антитела по сравнению с двумя другими группами с более высокой целевой дозой 5E+04 и 5E+03.

    Диапазон доз с VIC01. За хомячками следили (а) за изменением веса (линии представляют собой групповые средние значения, столбцы погрешностей представляют собой стандартное отклонение) и (b) за клиническими признаками (линии представляют групповые средние значения) после заражения VIC01.Хомячки, которым вводили 5E+04, в целом потеряли значительно больше веса (площадь под кривой), чем хомячки, которым вводили 5E+02 (P=0,0146) и 1E+02 (P=0,0058). Мазки из горла собирали на 2, 4, 6, 8, 10 и 14 дни для всех групп, подвергшихся заражению вирусом. ( c ) Суммарная вирусная РНК была количественно определена с помощью RT-qPCR во все моменты времени выборки. Линии показывают средние геометрические группы, планки погрешностей представляют собой стандартное отклонение. Пунктирные горизонтальные линии показывают нижний предел количественного определения (LLOQ) и нижний предел обнаружения (LLOD).У хомяков брали кровь из десен на сыворотку исходно, через 20 и 41 день после заражения для оценки гуморального ответа. (d) титры нейтрализующих антител, (e) антитела, связывающие IgG, специфичные для RBD SARS-CoV-2, (f) антитела, связывающие IgG, специфичные для шипа SARS-CoV-2, и (g) антитела, специфичные для шипа SARS-CoV-2, зависимое отложение комплемента оценивали у зараженных хомяков в исходном состоянии, на 20-й и 41-й день после заражения. Столбцы представляют собой групповые средние значения, а столбцы погрешностей представляют собой стандартное отклонение. Весь статистический анализ между группами проводился с использованием однофакторного дисперсионного анализа с поправкой Тьюки.Пунктирные горизонтальные линии представляют нижний предел количественного определения (НПКО) анализов. (h) Через 50 дней после заражения хомяков каждую дозовую группу разделяли на три и повторно заражали VIC01 или Omicron. Числа титров нейтрализующих антител (ND50) на 41-й день после заражения. Самцы и самки были поровну разделены между группами повторного заражения VIC01 и Omicron. Группы идентифицируются в соответствии с их «целевой» дозой.

    К 20-му дню антитела, связывающие рецептор-связывающие домены SARS-CoV-2 (RBD), специфичные для иммуноглобулина G (IgG), в сыворотке показали тенденцию к увеличению по сравнению с исходным уровнем для всех групп инфицированных хомяков.На 20 -й день титры RBD-специфических IgG-связывающих антител в группах 5E+04 были значительно ниже по сравнению с титрами антител в группах 5E+02.

    Примерно на 41-й день после заражения все зараженные группы показали снижение титров RBD-специфических связывающих IgG антител. Группа хомяков с целевой дозой 5E+04 показала значительное снижение титра антител с 20-го по 41-й день.

    Контрольные группы наивных хомяков, параллельно зараженных либо Omicron, либо вариантом VIC01, продемонстрировали, что сирийские хомяки восприимчивы к экспериментальному заражению вариантом Omicron SARS-CoV-2.Однако заражение хомяков высокой дозой варианта Омикрон вызывало меньше клинических признаков и меньшую потерю веса по сравнению с предковым вариантом SARS-CoV-2 при сопоставимой дозе. Напротив, выделение вируса в верхних дыхательных путях было одинаковым у хомяков, инфицированных VIC01 и Omicron.

    Повторное заражение сирийских хомяков вариантом Omicron или VIC01 не вызывает значительных клинических симптомов COVID-19 у хомяков, ранее инфицированных предковым вариантом SARS-CoV-2.

    Omicron и VIC01 Challenge у интактных хомяков. За хомяками наблюдали (а) изменение веса, (б) клинические признаки и (в) температуру после заражения VIC01 или вариантом Омикрон. У хомячков, подвергнутых заражению VIC01, наблюдалась значительно большая общая потеря веса (площадь под кривой, P=0,0007), чем у хомячков, подвергнутых заражению Omicron. Мазки из горла собирали на 2, 4, 6 и 7 дни для всех групп, подвергшихся заражению вирусом. ( d ) Вирусную РНК количественно определяли с помощью RT-qPCR во все моменты времени выборки.Линии показывают средние геометрические группы, планки погрешностей представляют собой стандартное отклонение. Пунктирные горизонтальные линии показывают нижний предел количественного определения (LLOQ) и нижний предел обнаружения (LLOD). На 6-й и 7-й день хомяки, зараженные Омикроном, выделяли значительно меньше вируса (P=0,0136 и P=0,0012 соответственно), чем хомяки, инфицированные VIC01. Не было существенной разницы между общим количеством слитой вирусной РНК.

    Выводы

    Результаты исследования показали, что заражение Омикроном у интактных сирийских хомяков привело к менее тяжелому заболеванию COVID-19 по сравнению с вариантом SARS-CoV-2 Australia/VIC01/2020.Точно так же клинические симптомы COVID-19 почти отсутствовали у выздоравливающих хомяков, повторно инфицированных вариантом Omicron через 50 дней после первоначального заражения вариантом SARS-CoV-2 Australia/VIC01/2020. Сильный клеточный иммунный ответ был связан с реинфекцией из-за наличия высоких циркулирующих антител через 50 дней после реинфекции.

    В целом, результаты текущего исследования показали, что иммунитет от инфекции SARS-CoV-2 дикого типа защищает от варианта Omicron в модели хомяка.Однако необходимы дальнейшие исследования, чтобы сделать вывод о том, является ли Омикрон менее патогенным для сирийских хомяков, и изучить влияние мутаций Омикрона, связанных с RBD, на людей.

    *Важное примечание

    bioRxiv публикует предварительные научные отчеты, которые не рецензируются экспертами и, следовательно, не должны рассматриваться как окончательные, направляющие клиническую практику/поведение, связанное со здоровьем, или рассматриваться как установленная информация.

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован.