+8 (916) 786-78-28 с 10.00 до 22.00 ежедневно

Меню

Малассезия у собак: Малассезионный дерматит у собак и кошек- перевод из SMALL ANIMAL DERMATOLOGY A COLOR ATLAS AND THERAPEUTIC GUIDE 2017г

Малассезия у кошек и собак

Содержание
  1. Грибок Malassezia pachydermatis
  2. Факторы развития
  3. Клиническая картина
  4. Лечение


Грибок Malassezia pachydermatis является липофильным дрожжевым грибком, который является нормальным обитателем микрофлоры здоровых собак и кошек. Правда, при благоприятных условиях, способствующих к размножению грибка , Malassezia может вызывать у кошек и собак дерматиты и наружные отиты. Грибок предпочитает для своего размножения влажные и теплые места, такие как наружный слуховой проход, складки кожи, подушечки лап, параанальные железы и др.

Факторы, благоприятствующие развитию грибка Malassezia

Расстройства физических, иммунологических и химических защитных факторов, которые обычно в нормальном (здоровом) состояние ограничивают микробную колонизацию кожи.

1.Частые купания.
2.Висячие уши
3.Различные повреждения кожи.
4.Себорея.
5.Хронические наружные отиты.
6.Влажные конечности(чаще всего встречается зимой).
7.Различные атопические заболевания.

На распространенность заболеваний грибком так же влияют и климатический факторы. Таким образом влажная и жаркая погода может благоприятствовать размножению грибка на коже, в то время как сухие погодные условия вовсе могут тормозить развитие Malassezia.

Клиническая картина

Поражения кожи грибком Malassezia pachydermatis могут быть генерализованными и локализованными. Чаще всего поражения можно увидеть на морде, щее, наружном слуховом проходе, межпальцевые складки кожи, живот и др.

Наиболее часто заболевание характеризуется неспецифическими поражениями кожи, такие как эритема, паппулы, бляшки, бляшки, алопециями. Зуд варьируется от слабого до тяжелого. Таким образом, дерматит при Malassezia может иметь сходство или возникать в связи с аллергическими заболеваниями, инвазиями эктопаразитами, или дефектами кератинизация.

Лечение

Прежде чем начинать лечение Malassezia нужно установить причины возникновения заболевания. Обязательно важно помнить, что поражение грибком чаще всего возникает как вторичное заболевание, а не самостоятельное.

Для лечения Malassezia pachydermatis используют местные обработки шампунем и различными растворами с имидазолом  и хлоргексидином. Часто требуется системное лечение кетокеназолом на протяжение 1-5 недель.

Статья подготовлена врачами отделения дерматологии «МЕДВЕТ»
© 2013 СВЦ «МЕДВЕТ»

Малассезия у собак — лечение на ушах, лапах, животе

Распространенное кожное заболевание, малассезия у собак. Ни одно животное не привязывается так к своему хозяину как пес, и именно за это мы их и любим. Но наши домашние животные тоже подвержены различным заболеваниям и хозяину нужно знать, как их распознать и лечить.

Что такое малассезия у собак

Вообще много микробов и бактерий располагаются на коже животных, но некоторые образуют симбиоз со своим носителем. Взаимовыгодное сосуществование достигается, ведь грибок малассезия, обитая на коже собаки, создает защитный слой, предотвращая попадание в организм иных болезней и вирусов, таких как золотистый стафилококк.

Но любая гармония может нарушаться при появлении неблагоприятных внешних факторов, приводящих к ослаблению иммунной системы собаки. При отсутствии защиты, грибок начинает активно размножаться, поражая большую часть кожи, и вызывая у собаки неприятные ощущения.
Как узнать, что ваш питомец заразился малассезией? Какая симптоматика болезни и причины его появления? Об этом и другом далее.

По сути это кожный грибок носящий название Malassezia pachydermatis. Его можно обнаружить на шкуре любого животного, так как он комфортно сосуществует с носителем, не причиняя вреда. У кого его точно не найдут это у северных животных, ведь дрожжевой грибок любит тепло и влагу. Взаимовыгодный симбиоз между грибком и животным выглядит так:

  1. Грибковый микроорганизм получает комфортную среду существования;
  2. Собака защитный покров в виде особой микрофлоры на коже, защищающей от проникновения иных опасных болезней;
  3. Естественно пес должен быть абсолютно здоров иначе создается благоприятная среда для размножения грибка и распространения по всему телу питомца;

Грибок малассезия располагается в местах:

  • В районе ушей;
  • Между пальцами лап, в основном задних;
  • В районе заднего прохода, а также прямой кишке;
  • В складках влагалища женских особей;
  • Также излюбленным местом для обитания являются складки на коже животного;
  • Подмышки;
  • На хвосте пса.

Наиболее подверженные породы

Особого влияния возраст или пол собаки не имеет. Единственное, некоторые породы собак особо подвержены распространению и переходу малассезийного грибка из обычной в опасную для здоровья фазу.

Вот они:

  • Кокер спаниель;
  • Такса;
  • Китайская порода псов Ши Тцзу;
  • Болонки;
  • Пекинес;
  • Ряд категорий терьеров;
  • Сеттеров;
  • Немецкие овчарки и те породы собак, у которых много складок на коже.

Жизнедеятельность этого дрожжевого грибка часто вызывает малассезионный отит у собак. Причина тому комфортная среда обитания в районе морды питомца.

Ученые и врачи до сих пор спорят о причине вызывающей резкое возрастание особей грибка. Единственная доказанная закономерность это чем слабее иммунная система животного, тем сильнее размножается грибок на коже собаки. Любое заболевание, переданное по наследству или подхваченное в процессе жизнедеятельности пса, может спровоцировать всплеск развития грибка малассезии.

Ветеринары считают, что выборочное нахождение грибка малассезии на определенных породах собак, связано с чистотой крови. Как известно иммунная система у «дворняг» намного крепче, поэтому они значительно реже болеют.

Быстрое размножение дрожжевого грибка обостряет течение уже имеющихся болезней. А также, из-за постоянного расчесывания животным пораженных мест, дополнительно открывает возможность для попадания иных инфекций в организм.

Чем опасно развитие грибка малассезии

Главная опасность малассезии в быстром размножении при возникновении комфортных условий. Одним из симптомов является сильный зуд в определенных местах, обычно ушей.

Из-за дискомфортных ощущений собака начинает интенсивно и яростно расчесывать зараженные грибком участки кожи, что приводит к возникновению ран и дает возможность другим опасным инфекциям проникнуть внутрь организма вашего любимца.

Усиление роста грибка малассезии может сопровождаться развитием дерматита собаки, псы-аллергетики также находятся в группе риска поражения болезнью. Еще опасность предоставляет наличие у собаки первичной себореии ее патологий. Заболевание влечет увеличение количества ушной серы, которую необходимо регулярно чистить.

Себорею может спровоцировать также долгий курс лечения рядом препаратов, поэтому обязательно требуется наблюдение у ветеринара.

Симптоматика грибковой болезни у собак

Самым ярким симптомом болезни является сильный зуд в местах локализации грибка. Собака чувствует дискомфорт и пытается таким образом избавиться от неприятных ощущений. Только это приводит лишь к скорейшему распространению грибка на лапы, а через низ дальше по коже питомца. Излюбленные места грибка влажная среда, поэтому часто это заболевание встречается на морде, ушах или лапах между пальцами животного.

Реже заболевание поражает анальную и вагинальную зоны. В этом случае собака постоянно катается в сидячем положении по полу, стараясь, избавиться от зуда. Иногда подобный симптом путают с наличием глистов у собаки, поэтому стоит идти к врачу, чтобы уточнить диагноз, а не заниматься самолечением.

Другим ярким признаком является себорея. Она быстро распространяется по коже домашнего животного, захватывая новые здоровые участки тела. Когда распространение грибка по телу животного находится в интенсивной стадии, у собаки появляются проплешины. Это явный признак уже запущенной стадии болезни.

Кожа воспаляется и покрывается красными пятнами. Также имеет место развитие экземы. Пигментные пятна в пораженном районе кожи животного приводят к ее огрубению и образования язв. Если грибок малассезия распространяется на ушах, это может спровоцировать активный рост ушных клещей. Явным симптом такого течения болезни это постоянное покачивание головы питомца с явным намерением сбросить с себя что-либо. Также обильное чесание, что приводит к образованию ран.

Локализация грибка более десятка особей говорит уже о запущенной стадии малассезии между пальцами, заставляет пса грызть лапы, тем самым создавая благоприятную среду для размножения дрожжей. Если вы заметили подобный симптом немедленно везите собаку к ветеринару, пока грибок не перешел на морду пса и дальше.

Запуск болезни в области лап собаки, часто приводит к развитию воспаления корней когтей вашего любимца, а в серьезных случаях необходимо полное их удаление.

Причины быстрого развития болезни

Есть ряд причин провоцирующих размножение грибка малассезии, перехода из пассивной жизнедеятельности в активную:

  • Резкое снижение иммунитета, спровоцированное недавно перенесенной болезнью собаки или нехваткой витаминов;
  • Наличие дополнительных инфекционных поражений у собаки: дерматит, лишайи прочие кожные инфекции;
  • Врожденные или приобретенные хронические болезни, провоцирующие регулярное ослабление иммунной системы собаки;
  • Присутствие аллергии у собаки. Подобная хроническая патология тоже снижает иммунную систему и провоцирует активное размножение патогенной флоры грибка малассезии;
  • Долгий прием лекарственных или гормональных препаратов, нарушает естественную функциональность всех важных органов и значительно ослабляет иммунитет, тем самым давая повод к размножению грибка на коже питомца;
  • Ряд внешних факторов снижающих иммунитет собаки, например климат. Лапы питомца, постоянно контактирующие с различными химическими веществами, вроде асфальта, могут дать благоприятную среду для размножения бактерий.

Лечение малассезии у собак может занять много времени причина тому активное и быстрое размножение грибка. Поэтому необходимо комплексно подходить к проблеме выздоровления вашего любимца и неукоснительно соблюдать все рекомендации врача.

Диагностирование малассезии

В качестве диагностики болезни используется лабораторное исследование, которое точно покажет причину возникшего заболевания. Наличие во время микроскопического исследования двух и большее количество грибковых микроорганизмов, является признаком начальной стадии болезни.

Присутствие более десятка грибковых особей говорит уже о запущенной стадии. Еще один способ обнаружения грибковой малассезии это исследование на активность размножения возбудителя. Берутся несколько особей и помещаются в специальную питательную среду, если в результате рост грибков был небольшим, значит, не малассезия была причиной возникновения зуда у собаки. В любом случае нужно обязательно обращаться с клинику, только там вам точно скажут причину неадекватного поведения вашего питомца и при необходимости назначат курс лечебной терапии.

Как проводить лечение собаки?

Лечение грибка малассезии у собак состоит из нескольких стадий:

  1. Первой стадией любого лечения является своевременное обращение за медицинской помощью.
  2. Чтобы лечение было эффективно необходимо создать среду враждебную для размножения грибка в местах распространения малассезии.
  3. Врачу необходимо определить, насколько запущена болезнь, и какой слой кожи поражен инфекцией. А также наличие сопутствующих болезней и бактерий.
  4. Если пострадал только верхний слой кожи, то действенной будет и местная терапия. Применяются кожные препараты вроде мазей или шампуней, в составе которых имеются: сера, хлоргексидин, миконазол.
  5. Есть некоторые шампуни, применяемые людьми, которые помогают снять симптомы зуда и устранить дискомфорт. После купания на сухую кожу животного наносится слой мази прописанной врачом.

Курс терапии занимает около 5-6 недель в зависимости от области поражения. Наносить средство нужно два три раза в день по предписанию доктора. Не используйте таблетированные препараты от грибков, если они не прописаны врачом. Когда грибок поразил ушную зону, то требуется регулярная очистка ушей. Сначала уши промываются борной кислотой, и после полного высыхания уха наносится мазь от грибка.


Совет: Многие противогрибковые лекарства имеют список противопоказаний и побочных эффектов, поэтому требуется постоянное наблюдение питомца у ветеринара. Следите за его поведением, если собака неадекватно реагирует на препарат, то его следует сменить.

Заключение

Важно точно определить причину, вызвавшую размножения малассезийного грибка и приступить к ее лечению. В противном случае не исключен рецидив, что повлечет еще большее ослабление иммунной системы собаки и к длительному курсу лечебной терапии. Как только вы заметили необычное поведение вашего питомца, когда он постоянно чешет определенные области на коже, то следует тут же отвезти его к врачу. Раннее выявление болезни поможет вовремя начать лечение и избежать осложнений.

Об авторе: Анна Александровна Максименкова

Практикующий ветеринарный врач в частной клинике. Направления: терапия, онкология, хирургия. Подробнее обо мне читайте в разделе «О нас».

Как и чем лечить малассезию у собак

Сегодня предлагаем вашему вниманию статью на тему: «как и чем лечить малассезию у собак» от профессионалов для людей. Мы постарались полностью раскрыть тему. Если что-то не понятно, то на все вопросы специалисты готовы ответить в комментариях.

Малассезия – это дрожжевой грибок, который обитает на коже большинства собак. При ослаблении иммунитета микромицета прорастает, поражая слуховые каналы, морду, анальную складку, межпальцевые пространства. Рассмотрим причины активизации малассезии, способы уничтожения патогенного грибка.

Дрожжи любят укромные, лишенные кислорода междукожные складки, где выполняют защитную функцию, не давая развиваться стафилококку. Однако, когда иммунная система собаки ослабевает, грибки начинают активно размножаться, вызывая заболевание. Малассезия поражает преимущественно пожилых животных. К заболеванию предрасположены собаки перечисленных ниже пород:

  • британские сеттеры;
  • кокер-спаниели;
  • таксы;
  • немецкие овчарки;
  • отдельные представители болонок, пуделей, терьеров.

Для человека и других пород собак малассезия не опасна.

Главной причиной возникновения недуга является ослабление иммунитета под воздействием следующих факторов:

  • дерматиты инфекционной и незаразной этиологии;
  • побочные действия медикаментов;
  • ненадлежащий или чрезмерный уход за шерстью;
  • аллергические состояния;
  • несбалансированное питание;
  • влажная жаркая погода.

Все заболевания, вызывающие зуд, приводят к расчесам. Отличительной особенностью длинноухих собак является чрезмерное накопление ушной серки, что создает анаэробные условия, благоприятные для развития дрожжей. Среди факторов, способствующих активизации микромицет, выделяют следующие:

При лечении хронических патологий применяют стероидные препараты, вызывающие гормональный сбой, характеризующийся кожным зудом и выпадением шерсти. Длительное использование антибиотиков, даже если не нарушается инструкция по их применению, приводит к уничтожению конкурентов дрожжей – условно болезнетворных бактерий.

Если не вычесывать волосы у длинношерстных собак, под ней накапливаются не отслоившиеся частички эпидермиса, конденсируется влага, то есть создаются условия для размножения дрожжей. Наибольшую опасность для собаки представляют их не наигравшиеся в куклы хозяйки. Частые купания с применением моющих средств удаляют с поверхности кожи вещества, защищающие ее от условно патогенных микробов.

Дефицит витаминов, несбалансированность корма по аминокислотам приводят к ослаблению иммунитета и увеличению продолжительности линьки.

У собаки отсутствуют потовые железы, поэтому они переносят жару, особенно влажную, тяжело. А для малассезии создаются благоприятные условия.

Для недуга характерны такие признаки:

  • зуд и расчесы на морде, в ушах, между пальцами;
  • себорея, шелушение кожи;
  • выпадение волос, возникновение аллопеций;
  • покраснение и утолщение шкуры;
  • выпотевание экссудата, развитие гнойного дерматита;
  • неприятный запах от пса.

При ненадлежащем лечении собака вылизывает пораженные участки и способствует разносу малассезии по всему туловищу, потому что теплая влажная слюна – идеальная для дрожжей среда обитания.

По клиническим признакам малассезия напоминает микроспорию. В первом случае наблюдают отит. Для уточнения диагноза проводят микроскопию, цитологическое и гистологическое исследование отобранного патматериала, а также культивирование возбудителя на питательных субстратах.

Терапевтические процедуры предусматривают использование стандартных схем лечения микотических поражений. При обнаружении локальных очагов применяют фунгицидные мази, спреи, шампуни. Масштабные поражения требуют обработки патологических участков лекарственными препаратами в форме растворов или таблеток. При дрожжевом поражении возникает отит, поэтому следует уделить пристальное внимание устранению воспаления.

Курс лечения грибковых заболеваний продолжается неделями. Антимикотики обладают массой побочных действий, поэтому ветеринарный врач в дополнение к лечению основного заболевания назначает иммуномодуляторы, общеукрепляющие средства, гепатопротекторы.

Востребованы такие лекарственные формы препаратов:

Востребованы следующие препараты:

Аэрозоли распыляют над воспаленными участками. Если лечение не приносит результата, меняют препарат или назначают оральные средства. Востребованы следующие спреи:

Их наносят на пораженное место на срок, указанный в инструкции, например, 10 минут, и смывают водой. Широко применяются следующие препараты:

  • Низорал;
  • Кетоназол/Хлоргексидин;
  • Миконазол;
  • Пчелодар.

Применяют, когда требуется обработка больших участков поражения или всей собаки. Популярны указанные ниже средства:

Причиной возникновения отитов у собаки редко бывает один возбудитель. Чаще всего грибковые отиты сочетаются с паразитированием ушного клеща отодектеса. Поэтому и препараты следует выбирать многопланового действия. Лучше всего работают лекарства, в состав которых входят антимикотики, антифлогистанты, антисептики, акарициды, антигистаминные вещества. Лучшим препаратом считают Суролан. Приемлемой заменой ему является Аурикан. Перед обработкой основным лекарством уши очищают борным спиртом.

Оральные средства обладают побочными эффектами, поэтому их назначают, когда другие препараты не помогают. Популярны перечисленные далее средства:

Малассезия поражает собак со сниженным иммунитетом. Выполнение оптимальных условий содержания и сбалансированное кормление предотвратят развитие грибка. К профилактическим мероприятиям следует отнести уход за шерстью и преодоление привычки купать собаку с применением моющих средств без крайней необходимости. По согласованию с ветеринарным врачом проводят профилактику при помощи Гамавита, Иммунофана или другого иммунокорректора.

Малассезия постоянно находится на собаке, но заболевание вызывает при ослабленном иммунитете. Существует большое количество препаратов для лечения недуга, но лучшим способом борьбы с ним является профилактика.

Причины возникновения и методы лечения малассезии у собак

Малассезия (Malassezia) – дрожжевой грибок, существующий на коже абсолютного большинства животных, включая собак, живущих в наших широтах. Лайки и северные олени счастливее в этом плане, так как холодный климат и отрицательную температуру воздуха этот микроорганизм не любит и в таких условиях не живет.

Теплокровные животные носят на своей коже большое количество различных грибков и других микроорганизмов. Причем многие из этих жителей в обычных условиях не оказывают никакого вреда здоровью своих хозяев, а иногда даже приносят определенную пользу. Но стоит иммунитету упасть – все меняется. Безобидный грибок превращается в агрессивного возбудителя. Он атакует ослабленный инфекцией организм, распространяя свои колонии на слизистые оболочки и нежную кожу в местах природных складок (межпальцевые пространства, область губ, слуховые проходы). Малассезия у собак – один из таких коварных грибков.

Всего известно около десяти разновидностей грибка малассезии, но на собаках живет только один его вид – pachydermatis. Жизнедеятельность этого микроорганизма достаточно хорошо изучена. Достоверно известно о нем следующее:

  • Его колонии постоянно присутствуют на слизистых и кожных покровах у абсолютного большинства собак.
  • Размножается он монополюсным почкованием. Любое изменение в состоянии здоровья хозяина вызывают мгновенную реакцию микроорганизма. Скорость образования его колоний резко возрастает. Остановить этот лавинообразный процесс может только противогрибковая терапия.
  • Колонии грибка любят локализоваться в наружных слуховых проходах, на морде, на передней части шеи, в межпальцевых пространствах, в области анального отверстия.
  • В обычных условиях организмы грибков малассезии и их хозяев – собак живут во взаимовыгодном симбиозе. Грибок находится в благоприятных для себя условиях, а на кожных покровах собаки благодаря ему формируется особая защитная среда. Она препятствует вторжению возбудителей некоторых инфекционных заболеваний (в частности, золотистого стафилококка).
  • Ослабленный иммунитет собаки – сигнал для малассезии к переходу в агрессивную патологическую форму.

Процент грибковых поражений среди мужских и женских особей практически одинаков. Почтенный возраст делает вероятность заболевания более высокой, и это не удивительно. Пожилые собаки чаще подвержены инфекциям, имеют более низкий иммунитет, чем молодые и полные сил.

Малассезионный дерматит может встречаться у любой породы собак. Но есть несколько пород, больше других подверженных этому грибковому поражению. В этот список попали:

  • таксы;
  • английские сеттеры;
  • кокер-спаниели;
  • шотландские белые терьеры;
  • миниатюрные пудели;
  • бассет-хаунды.

Предполагается также, что влажная жаркая погода может благоприятствовать распространению грибковой инфекции, в то время как сухие и прохладные погодные условия мешают ему.

Для того чтобы уберечь свою собаку от заболевания и при необходимости сразу же принять меры, нужно знать, какие факторы могут благоприятствовать активному росту грибка на коже и диагностировать возможные сопутствующие заболевания.

Достоверно известно, что заболевание незаразно. Оно не передается от собаки к собаке. Недуг имеет внутренние причины. Для людей и других животных собачий грибок малассезия тоже не заразен.

Многолетний опыт разведения собак позволил специалистам сделать вывод об основных причинах активной полиферации (распространения) грибка на коже животных, среди которых:

  • ослабленный иммунитет;
  • инфекционные заболевания;
  • хронические заболевания;
  • аллергические реакции различной этиологии;
  • любые кожные заболевания, нарушающие целостность кожного покрова;
  • прием гормональных средств и антибиотикотерапия;
  • слишком частое применение шампуней и других моющих средств;
  • плохой уход за густой длинной шерстью.

Основная причина болезни – ослабленный иммунитет. Низкая сопротивляемость кожным инфекциям может носить наследственный характер, а может представлять собой хроническое заболевание. Наследственный недуг диагностируется очень рано, когда кожные болезни начинают атаковать щенка в самом нежном возрасте.

Хронические болезни не менее опасны, так как они вызывают стойкое снижение иммунитета. Постоянно прогрессируя, они создают благоприятные условия для роста колоний грибка – захватчика. Кожный покров собаки для них становится патогенной средой, которую они стараются всеми силами подавить.

Кожные инфекционные заболевания имеют тот же итог – иммунодефицит. К тому же многие из них характеризуются сильным неутихающим зудом. Расчесанная до крови кожа – это ворота для болезнетворных микроорганизмов. А патологические организмы для грибка – знак к бурному размножению для борьбы «за территорию».

Аллергическая реакция на коже создает те же самые условия (расчесы, нарушение целостности кожного покрова, снижение иммунитета) побуждающие микроорганизмы активно размножаться.

Гормонозаместительная терапия в большинстве случаев имеет побочные эффекты. В частности, это неблагоприятное воздействие на органы эндокринной системы. Их функции могут нарушаться, отчего страдает выработка естественных гормонов. Все это не лучшим образом сказывается на состоянии кожных покровов. А это прямой путь к активизации роста грибков.

Прием антибактериальных средств тоже имеет свои отрицательные стороны. Активно подавляя рост болезнетворных бактерий, они в то же время наносят существенный удар по защитным функциям организма. Поэтому каждый прием антибиотиков должен сопровождаться параллельным приемом антимикотических и иммуностимулирующих средств.

Один из главных факторов защиты от грибковой инфекции – это сохранение целостности кожного покрова. Искусственно нарушить эту целостность могут часто применяемые шампуни и моющие средства. Они смывают защитный слой эпидермиса, и кожа становится сухой и восприимчивой к различным инфекциям.

Но в то же время, необходим тщательный уход за ушами. Там имеется благоприятная среда для развития малассезии – теплая и влажная среда. Ушные проходы следует своевременно чистить от серных выделений, каждый раз вытирая их насухо.

Длинная, плохо расчесанная шерсть создает препятствие для хорошего воздухообмена и проветривания кожного покрова. Влажность и высокая температура кожи делают возможным быстрое размножение на ней грибковых инфекций.

Малассезия определяется по характерным симптомам. Их список невелик, но дает довольно ясную картину заболевания. В зависимости от стадии болезни грибковое поражение кожи может быть локализованным или генерализованным (охватывающим весь кожный покров).

  • Сильный зуд. Это основной и самый мучительный симптом. Собака теряет покой. Зуд локализуется в местах грибковых поражений и захватывает новые участки в соответствии с распространением грибка по поверхности кожи. Пораженные места расчесаны до крови. Если собаку не подвергнуть лечению, то языком она будет разносить грибковую инфекцию еще дальше.
  • Шелушение кожи и жирная себорея. Пораженные участки шелушатся, ороговевшие чешуйки видны как перхоть на шерстном покрове.
  • Эритема кожи. Этот симптом внешне характеризуется покраснениями, сыпью, расширенными капиллярами.
  • Выпадение шерсти, образование проплешин.
  • Гиперпигментация. Кожные покровы темнеют, теряют эластичность.
  • Лихенизация. Так называется утолщение кожного покрова, изменение ее естественного рисунка.
  • Экссудация. Резкая отечность пораженной кожи и слизистых оболочек. Гнойный экссудат может свидетельствовать о присоединении вторичной инфекции.

Все эти симптомы хорошо определяются при визуальном осмотре животного. Наблюдая, можно без труда заметить, что в его поведении есть некоторые особенности. Еще один характерный симптом – неприятный запах от собаки.

Визуальный осмотр, наряду с микроскопическим, цитологическим и гистологическим исследованием взятого у собаки материала является неотъемлемой частью диагностического процесса. Если место локализации возбудителя – кожные покровы, диагноз обычно звучит как «малассезионный дерматит». Если затронуты ушные проходы, тогда диагностируют малассезионный отит.

Суть лечения – создание условий, неблагоприятных для дальнейшего развития грибковой инфекции. Схема лечения должна составляться исключительно специалистом, а задача хозяев собаки – тщательно следовать ей. Воздействие на грибок должно быть комплексным и включать процедуры как местного, так и общего воздействия на организм:

  • использование шампуней с хлоргексидином и миконазолом;
  • применение противогрибковых препаратов «Флуконазол» и «Кетоконазол»;
  • при поражении ушей – показан препарат «Отоназол»;
  • ежедневная тщательная чистка ушей с применением борного спирта;
  • использование антимикотических мазей «Клотримазол», «Нистатиновая»;
  • восстановление сопротивляемости организма при помощи иммудомодулирующих и иммуностимулирующих препаратов.

Лечение малассезии у собак продолжается от 2 до 5 недель в зависимости от тяжести течения болезни. Лечебный процесс должен проходить под тщательным контролем ветеринара.

Правильно подобранное лечение обязательно даст свой эффект, и вы скоро не узнаете своего питомца: он повеселеет, шерсть заблестит, появится аппетит. Но знайте, что если у вашей собаки есть природная предрасположенность к малассезии, то ее ждет пожизненная иммуностимулирующая и антимикотическая терапия.

Малассезия (грибок) у собак: симптомы, диагностика, лечение

Грибковые заболевания достаточно широко распространены в природе, и ветеринары с медиками встречаются с их проявлениями у своих питомцев с печальной регулярностью. Но, вопреки распространенному мнению, грибы и дрожжи далеко не всегда вызывают инфекцию при попадании в организм. Более того, многие из них постоянно находятся на коже людей и домашних животных, лишь при определенных условиях способствуя возникновению патологии. Хороший тому пример — малассезия у собак.

Malassezia pachydermatis – таково название дрожжевого гриба, который в обычных условиях может быть найден на шкуре едва ли не каждой собаки в мире. Ну, за исключением, быть может, животных, эксплуатируемых в условиях Крайнего Севера и Антарктики. В обычных случаях сосуществование микроскопического грибка и млекопитающего выгодно обоим организмам: гриб получает теплую и защищенную среду, а на коже собаки формируется особая микрофлора, препятствующая проникновению возбудителей опасных инфекций. В частности, уже доказано, что дрожжи могут уничтожать золотистого стафилококка.

Но идиллия однажды может закончиться. Если организм животного под влиянием каких-то негативных факторов среды ослаб, а его иммунный статус значительно снизился, до беды недалеко.

Где живет гриб, существуют ли предрасположенные породы?

Грибок обычно находится в наружном слуховом проходе, в межпальцевой области (чаще всего на задних лапах), параанальных синусах, влагалище и прямой кишке здоровых собак. Заболеванию подвержены все животные, вне зависимости от возраста и пола. Но практикующие ветеринары по всему миру сходятся во мнении, что чаще всего малассезия может быть обнаружена у следующих пород собак:

В каких условиях возникает заболевание, из-за чего это происходит?

Malassezia является условно-патогенным организмом. Это означает, что дрожжи вполне нормально уживаются с собакой в нормальных условиях, будучи даже иногда полезны. Но мирное сосуществование кончается в тот момент, когда иммунитет животного резко снижается. Любое наследственное заболевание или инфекционная болезнь, ослабляющая иммунную систему, способствуют бурному развитию и росту патогенного гриба. Например, собаки, страдающие от бактериального дерматита, аллергии или себореи, часто до крови расчесывают и царапают шкуру (на фото), что открывает ворота инфекции.

Кроме того, очень опасна первичная себорея и патологии, сопровождающиеся накоплением повышенного объема ушной серы. Длительное использование определенных лекарств, таких как глюкокортикоиды (например, преднизон) или антибиотики, также может способствовать развитию заболевания.

Каковы симптомы малассезии у собак? Постоянно зудящая кожа – вот основной признак, характерный для всех кандидозов. Из-за этого собака постоянно чешет и травмирует свою шкуру, лишь усугубляя течение болезни. Дрожжи могут расти практически по всей поверхности собачьей кожи, но чаще всего их можно обнаружить на морде, в ушах, они же вызывают сильное воспаление параанальных синусов (но это все же редкость). У собак с разлитой формой болезни часто развивается вторичная себорея, сопровождающаяся появлением жирной, «чешуйчатой» кожи.

Собаки с локализованными инфекциями морды постоянно ее трут и царапают. Если инфекция развилась между пальцами, пес постоянно слюнявит свои ноги в пасти и даже грызет их от нестерпимого зуда. В теплой и влажной среде, «сдобренной» собачьей слюной, дрожжи чувствуют себя еще лучше, а потому состояние животного быстро ухудшается. Потеря волос, краснота, гиперпигментация (потемнение) и утолщение кожи наблюдаются практически во всех случаях.

В случае, если малассезия у собак в ушах, течение болезни может быть осложнено еще и деятельностью ушных клещей. Собака при этом постоянно качает головой и остервенело чешет свои уши. На последних можно постоянно видеть царапины и даже разрывы. Часто от ушей начинает идти крайне неприятный, гнилостно-кисловатый запах.

Одним из наиболее точных методов «опознания» возбудителя в данном случае считается микроскопия. Но куда точнее выращивание дрожжей на особой питательной среде. Поскольку Malassezia может присутствовать и на здоровом животном, точный диагноз все же ставится в зависимости от того, реагирует ли питомец на проводимую терапию. Кстати, а как осуществляется лечение малассезии у собак?

Основной задачей при этом является создание среды, которая враждебна к возбудителю. Для этого пользуются препаратами на основе хлоргексидина, серы и прочих. Интересно, но некоторые шампуни для людей (Head & Shoulders) могут оказаться неожиданно эффективными: такое лечение «народными средствами» значительно облегчает симптоматику. Ветеринары также назначают специальные мази, использовать которые следует не реже двух раз в день, общая продолжительность лечения – не менее нескольких недель.

Орально назначается кетоконазол, флуконазол и аналогичные препараты. Что делать, если инфекция угнездилась в ушах? В этом случае вам придется их чистить, причем делать это необходимо не реже двух-трех раз в день. Хорошо подходит обычный борный спирт. После того как ухо высохнет, применяют нистатин, тиабендазол или кломитразол. Вот чем лечить малассезию.

Важно помнить, что лечение этого заболевания (как и всех грибковых патологий) отнимает далеко не пару дней! Вам лучше сразу настроиться на несколько недель усиленной терапии. Причем собака постоянно должна быть под надзором опытного ветеринарного врача, так как используемые при этой болезни противогрибковые препараты далеко не безвредны. Если вы видите рвоту или неадекватное поведение своего пса после их применения, немедленно вызывайте своего ветеринара!

Малассезия представляет собой неопасный дрожжевой грибок. При отсутствии патологии, он обитает в ушных канальцах собаки. Но в некоторых случаях развитие этого грибка способствует возникновению неблагоприятных последствий.

Малассезия представляет собой симбиоз дрожжевых грибков. Он селится на кожном покрове теплокровных животных. Чаще всего он встречается у собак.

Жизнедеятельность этого микроба связывается с прогрессированием наружного отита. Но окончательно эта связь не доказана.

Для других четвероногих и человека этот грибок не заразен.

Малассезия от собаки к человеку не передаётся.

В группе риска немецкая овчарка!

Патология чаще всего выявляется у:

  1. Немецких овчарок.
  2. Терьеров.
  3. Такс.
  4. Пекинесов.
  5. Бассет-хаундов.

Часто болезнь диагностируется у такс.

Патогенная форма малассезии развивается на фоне ослабления иммунной системы собак. Обычно это сопровождается прогрессированием сопутствующих патологий.

Грибок начинается развиваться у собак с ослабленным иммунитетом.

Переход от нормы к патологии обосновывается:

  • применением некоторых медикаментов;
  • микроклиматом;
  • развитием заболеваний;
  • аллергической реакцией;
  • чесоткой.

Нормальному функционированию внутренних органов препятствует применение гормональных лекарственных средств. Они могут частично блокировать функционирование эндокринной системы.

Ослаблению иммунной системы способствует продолжительный приём антибиотических препаратов. На этом фоне грибок растёт и активно развивается.

Долгий приём антибиотиков действует на иммунную систему.

  1. Когда конечности собаки соприкасаются с дорожным покрытием, на них попадают химические реагенты.
  2. Это способствует понижению местного иммунитета.
  3. Взаимодействуя с влажной средой, дрожжевые микробы развиваются ещё более стремительно.

Химические реагенты с дороги не благоприятно сказываются на здоровье собаки.

Переход условно-патогенного грибка в патогенную форму обусловлен:

  1. Дерматитом.
  2. Развитием лишаёв.
  3. Развитием различных хронических патологий.

У собаки дерматит.

На этом фоне наблюдается стремительное распространение грибного мицелия по всему телу собаки.

Возникает у гиперчувствительных к раздражителям пород собак. Аллергия способствует резкому ослаблению иммунной системы. Микроорганизм воспринимает это как сигнал к действию.

Иммунитет понижается у гиперчувствительных собак из-за аллергии.

  1. Если питомец страдает от зуда, он расчёсывает кожный покров до крови.
  2. В царапинки, которые образуются в результате расчёсов, попадают болезнетворные бактерии.
  3. Начинается борьба с грибком за площадь.

В ранки после расчёсов могут попасть болезнетворные бактерии.

Процентное соотношение участков местонахождения опасного микроорганизма представлено в следующей табличке:

Облысение является симптомом малассезии.

Превращение нормального грибка в патогенный сопровождается:

  • зудом;
  • шелушением кожного покрова;
  • кожной эритемой;
  • облысением;
  • гимерпигментацией;
  • экссудацией;
  • лихенизацией.

Оттенок кожи животного становится специфическим. Это обусловлено реакцией собачьего организма на развитие воспалительного процесса.

Воспаление сопровождается сменой оттенка кожи.

На кожном покрове образуются узелковые опухоли, сосочки слизистой отекают.

В некоторых случаях наблюдается гнойная форма, что говорит о сильном воспалении.

При сильном воспалении может образоваться гной.

Инфекционный процесс развивается стремительно.

Владелец животного сам может поставить первичный диагноз. Для этого достаточно осмотреть собаку.

  1. Ветеринарный врач обязуется сделать забор кожных анализов на грибковую колонию. Результат положителен.
  2. После этого врач узнаёт число грибков. Если это необходимо, проводится высевание на питательную среду. Этот диагностический метод считается более информативным.

Диагностику проводит ветеринарный врач.

Основной целью терапии следует считать понижение концентрации грибка на кожном покрове. Второй важной задачей является уничтожение сопутствующих грибку бактерий.

Главная цель лечения — уничтожить грибок.

Очень важно знать, в каком именно слое кожного покрова живёт грибок. Если он не проник глубоко, то применяются местные средства.

Собаке прописываются средства на основании хлоргексидина и серы . Рекомендовано применение шампуней и мазей. Разрешается использование человеческих шампуней, помогающих бороться с перхотью.

Для лечения назначаются специальные шампуни.

В составе шампуня должен находиться 2% миконазол, а также 2% хлоргексидин. Эти вещества способствуют обезжириванию кожного покрова.

Купать питомца таким шампунем рекомендуется 5–6 недель. Это помогает предотвратить возникновение рецидивов.

Мази помогают избавиться как от экссудации, так и от неприятного «аромата». Рекомендовано использование Флуконазола, Клотримазола. Применять мази следует в течение 3–4 месяцев.

Рекомендуется применять мазь Клотримазол .

Для обработки ушей подойдёт мазь Нистатин.

Уши животного нужно чистить не менее 3 раз за сутки. Если возникает необходимость, их следует обрабатывать специальными мазями:

Некоторые местные средства оказывают неблагоприятное воздействие на собачий организм.

Если собака становится вялой, плохо ест, наблюдаются нарушения стула, то их применение нужно прекратить.

Отказ от еды и вялость говорят о том, что лечение следует прекратить.

Следующим шагом будет обращение к ветеринарному врачу.

Противогрибковые препараты собаке дают примерно полгода.

  • Собаке назначается регулярное применение противогрибковых препаратов . Продолжительность терапевтического курса — 5–7 месяцев.
  • Обязательно нужно проводить анализ на цитологию . Заболевание считается вылеченным, если в анализах отсутствуют грибки.
  • Животным с породной предрасположенностью нужно до конца жизни давать препараты, с тимулирующие иммунитет .
  • Но также рекомендована симптоматическая дача противомикотических лекарственных средств.

Специальной диеты не назначается. Но рацион собаки должен быть сбалансированным. Нельзя давать ей жирную пищу. Не рекомендуется кормить питомца со стола.

Корм животного должен быть качественным, гипоаллергенным.

Корм для собаки должен быть сбалансированным и не вызывать аллергию.

Во время терапии необходимо регулярно водить животное на осмотр к прописавшему лечение ветеринарному врачу.

Терапия требует регулярного посещения к ветеринару.

Автор статьи: Артем Щетинин

Здравствуйте. Меня зовут Артем. Я работаю ветеринаром уже более 9 лет. Считая себя профессионалом, хочу научить всех посетителей сайта решать сложные задачи и дать ответы на самые часто задаваемые вопросы. Все данные для сайта собраны и тщательно переработаны для того чтобы донести в доступном виде всю требуемую информацию. Перед применением описанного на сайте всегда необходима консультация с профессионалами.

✔ Обо мне ✉ Обратная связь Оцените статью: Оценка 4. 4 проголосовавших: 85

Малассезия у собак: симптомы и лечение

Содержание статьи:

Редкий владелец собаки не любит погладить своего домашнего питомца, потрепать его за шею, посадить любимца себе на коленки. Омрачить радость общения может любое кожное заболевание у собаки, из которых малассезия является одним из самых широко распространённых. Симптомы недуга нередко похожи на проявления других видов дерматита, а потому, чтобы выработать эффективное лечение, необходимо посещение ветеринарной клиники, где с помощью специального оборудования проведут грамотную диагностику.

Общие сведения

Малассезия является кожным заболеванием у собак, в роли возбудителя которого выступает одноименный дрожжевой грибок – Malassezia pachydermatis. Он обитает на шерстяном покрове практически каждой собаки. В нормальных условиях между грибком и собакой наблюдается своеобразный взаимовыгодный синтез – дрожжевой микроорганизм оказывается в комфортных условиях существования, а у животного образуется микрофлора, являющаяся преградой на пути к проникновению в организм возбудителей многих опасных заболеваний. Особенно эффективно данные микроорганизмы действуют против золотистых стафилококков. Тем не менее, для взаимовыгодного сотрудничества требуется наличие крепкой иммунной системы собаки, в противном случае активность малассезии может привести к неприятным последствиям.

Малассезии локализуются в районе ушных отверстий, между пальцами задних лап, в области параанальных желёз, прямой кишке и влагалище собаки, под мышками, на хвосте. Возрастной и половой предрасположенности к заболеванию не выявлено. Тем не менее, определённые породы собак страдают от недуга чаще других особей. Больше всего случаев заболевания зафиксировано у такс, кокер-спаниелей, сеттеров, ши-тцу, болонок, немецких овчарок, терьеров, а также у пород собак с многочисленными кожными складками. Другим видам животных и людям малассезия не передаётся.

Малассезия относится к числу условно-патогенных микроорганизмов, сосуществующих с организмом носителя во взаимовыгодном синтезе. Сам грибок небольшой, овальной формы, похож на земляной орех. Защитные механизмы на кожном покрове не позволяют грибку размножаться и распространяться настолько, чтобы это несло вред организму. Длится подобная идиллия ровно до того самого момента, как организм носителя не ослабевает. В этом случае грибок, начиная активное размножение, провоцирует обострение хронических, инфекционных, наследственных заболеваний.

Другими факторами, способствующими активизации паразитарных микроорганизмов, называются развитие дерматита и наружного отита. Грибок хорошо размножается во влажной тёплой среде, например, на коже, особенно если кожный покров затронут воспалительным процессом. Усилению активности данных микроорганизмов способствуют нарушения гормонального фона в организме, аллергические реакции, низкий уровень иммунитета.

Если в организме собаки протекало в вялотекущем режиме кожное заболевание, то при разрастании колонии грибков животное начнёт яростно расчёсывать беспокоящий участок кожи. Тем самым животное не только способствует разнесению микробов по всему телу, но и создаёт благоприятные условия для попадания в организм возбудителей вторичной инфекции. Особую опасность увеличение количества болезнетворных микроорганизмов создаёт при заболеваниях, ведущих к образованию ушной серы.

Симптомы

Основным симптомом малассезии является постоянный кожный зуд. Желая избавиться от неприятных ощущений, собака непрестанно чешется, лишь ещё больше способствуя распространению микроорганизмов, вызывающих чесотку. Дрожжевой грибок рассеян по всему телу собаки, но особо часто он встречается на кожных складках морды и в районе ушей. Воспаление параанальных синусов также вызывается в основном неконтролируемым размножением малассезии. Другим распространённым последствием чрезмерной активизации дрожжевого грибка является развитие вторичной себореи, распознать которую можно по жирной чешуйчатой коже.

На поверхности шерстяного покрова собаки появляются проплешины, происходит покраснение отдельных участков кожи (эритема), утолщение и гиперпигментация кожного покрова, некоторые места на коже начинают шелушиться. Локализация дрожжевого грибка в районе ушей может привести к активному размножению ушных клещей. Признаками подобного развития событий будет покачивание собаки головой и яростное расчёсывание ей своих ушей. В результате на поверхности ушей появляются расчёсы, царапины, разрывы, ушные раковины издают неприятный запах, похожий на смесь гнильцы и кислоты. Малассезия может привести к воспалению области около корней когтей.

Если инфекция затронула кожные складки на морде, собака будет постоянно тереть её лапами и царапать когтями. Когда грибок локализуется в межпальцевой области, питомец непрерывно  облизывает пальцы лап, держит их во рту, грызёт. Это способствует ещё большему размножению грибка, так как слюна создаёт благоприятные условия для обитания болезнетворных микроорганизмов.

Диагностирование

Наличие грибка выявляется при помощи микроскопического метода диагностики. Обнаружение при помощи микроскопа двух и более экземпляров грибка является признаком начальной стадии инфекционного поражения. Если в окуляре микроскопа удалось увидеть более десяти экземпляров грибка, то это свидетельствует о запущенной стадии заболевания. Другим надёжным средством обнаружения возбудителя заболевания является способ, при котором дрожжевые грибки выращиваются в специальной питательной среде. Если в посеве проявилось небольшое количество грибков, то результаты диагностического исследования не будут иметь ценности, так как такое явление характерно для здорового состояния собаки.

Малассезии присутствуют на шерсти почти любой собаки, поэтому определяющим аргументом в пользу положительного диагноза является реакция организма животного на проводимые терапевтические мероприятия. Количество микроорганизмов определяется при помощи цитологического метода диагностирования, при котором ветеринар исследует полосы на лейкопластыре. В ходе исследования происходит окрашивание препаратов, взятых с кожи или ушных соскобов. На скотч-ленте грибки окрашиваются в сине-фиолетовый, светло-красный, светло-голубой цвета.

Лечение

Основа лечения малассезии – формирование условий, неблагоприятных для обитания возбудителя болезни. В задачу ветеринара входит уменьшение количества паразитарных микроорганизмов на кожном покрове, а также сопутствующих им бактерий. Перед началом лечения необходимо выяснить, какой именно слой эпидермиса поражён инфекцией. Если заболевание затронуло только поверхностный слой, то можно будет ограничиться местной терапией. С её помощью можно уменьшить выделения экссудата и устранить неприятный запах.

Как правило, лечение проводится при помощи препаратов, содержащих хлоргексидин, серу, миконазол. Эффективно устранить симптомы помогут даже некоторые шампуни для людей. Рекомендуется обрабатывать кожный покров собаки указанными средствами на протяжении не менее пяти недель для того, чтобы не допустить рецидива заболевания. Специальные мази следует наносить на поражённые участки как минимум два раза в день в течение нескольких недель. Имейте в виду, что некоторые противогрибковые средства, выпускаемые в виде таблеток, могут привести к нежелательным побочным эффектам в виде анорексии, рвоты, диареи, болезненного состояния печени.

Если грибок локализуется в наружном слуховом проходе, то необходимо проводить регулярную очистку ушей. Вначале ухо промывается при помощи борной кислоты, а затем, как только ушная раковина просохнет, на поверхность уха наносится противогрибковая мазь. Обычно лечение малассезии, как и любого заболевания грибкового происхождения, занимает несколько недель. При этом состояние собаки должен наблюдать опытный ветеринар, так как противогрибковые препараты обладают побочными эффектами, к числу которых относятся рвота, изменения в поведении домашнего животного.

Основным признаком малассезиозного дерматита является наличие генерализованных и локализованных очагов, которые беспокоят собаку зудом. Прежде чем начинать лечение малассезиозного дерматита, необходимо определить причину размножения болезнетворных микроорганизмов. Заболевание возникает у пород собак со складчатым кожным покровом, особенно подвержены недугу бассет-хаунды. Зуд может быть как сильным, так и незначительным.

Лечение малассезиозного дерматита проводится при помощи системных противогрибковых средств и местных противогрибковых шампуней. Терапевтические мероприятия должны проводиться не менее трёх недель, а если первопричина малассезиозного дерматита не была устранена, то симптоматическое лечение необходимо продолжать и дальше. В случае рецидива малассезиозного дерматита ветеринаром осуществляется поддерживающая терапия, основу которой составляет применение местных или системных противогрибковых средств. Если лечение основной болезни, вызвавшей неконтролируемое размножение патогенных микроорганизмов, не увенчалось успехом, то насовсем удалить грибок с кожи не удастся.

Малассезиозный отит лечится местной терапией, основу которой составляют противогрибковые капли и чистка слухового прохода. Впрочем, если возбудитель болезни локализуется в районе ушных раковин, слизистых кожных складок, межпальцевой области лап, то следует проводить обработку противогрибковыми препаратами всей поверхности кожи, так как данные участки являются резервуарами грибка. Курс лечения можно считать успешным, если цитология, взятая через полторы недели после начала приёма препаратов, показывает отрицательные результаты. Иногда после использования обезжиривающих шампуней возможно возникновение побочных эффектов в виде сухой и раздражённой кожи. В таком случае рекомендуется ополаскивание собаки смягчающими средствами.

[Всего голосов: 23    Средний: 3.7/5]

в ушах, на лапах, на когтях, на носу, на спине. Грибок шерсти у собак.

Существует большое количество самых разнообразных кожных заболеваний, многие из этих болезней у собаки вызываются грибками. Что это за заболевания, как они проявляются у собак, как отличить болезни кожи, имеющие грибковую природу, какое лечение может потребоваться, мы расскажем в нашей статье.

Кожа – это огромный и очень важный барьерный орган, защищающий организм. Неудивительно, что часто кожа поражается различными инфекциями. Существенная доля этих требующих лечения заболеваний у собак — грибковой природы; такие заболевания называются также дерматомикозами.

Стригущий лишай (микроспория, трихофития)

Одна из самых распространённых грибковых инфекций у собак, лечение от которой может потребоваться вашему питомцу – это стригущий лишай. Эту инфекцию вызывают разнообразные микроскопические грибки: Microsporum canis, Microsporum gypseum, Trichophyton mentagrophytes. Если у хозяина есть собака, больная дерматофитией, лечение от лишая может потребоваться и ему: это заболевание передаётся человеку. Возбудитель может передаться от других больных животных, через посуду, подстилки, игрушки. Впрочем, и животные, и люди имеют разную устойчивость к возбудителям: возможно латентное носительство без проявления признаков заболевания. Подробнее о видах лишая смотрите статью «Лишай у собак», здесь же мы лишь кратко коснёмся возможных симптомов и лечения дерматофитозов у собак.

Симптомы стригущего лишая. Стригущий лишай у собак – кожный грибок, требующий лечения – может возникать на различных частях тела: на голове, носу и ушах, на лапах, на спине, у основания хвоста. Иногда грибок возникает только в межпальцевом пространстве, вокруг когтей и на когтях у собаки. Это заболевание начинает проявляться как воспаление кожи, грибок у собаки вызывает такие симптомы, как зуд и шелушение, образуются пузырьки. В результате заражения грибком шерсть у собаки обламывается близко к корню, становится как бы подстриженной – отсюда и название заболевания. Кроме появления воспалённых участков на коже у собаки, грибок приводит к поражению волосяных фолликулов и развитию вторичной инфекции. Диагноз ставится на основании сочетания симптомов, люминесцентного анализа (достоверен не для всех видов возбудителя) и микроскопических исследований.

Лечение кожного грибка у собак. Как же вылечить грибок у собаки, вызывающий стригущий лишай? Прежде, чем начать лечить вашего питомца, следует выстричь шерсть вокруг пораженных участков на коже у собаки – это облегчит обработку от грибка. Также эта процедура в процессе лечения микозов важна тем, что избавляет шерсть у собаки от большинства спор дерматофитов. Основными лекарственными средствами для эффективного лечения грибка кожи у собак являются противогрибковые препараты. Медикаменты, призванные лечить грибок у собаки, в зависимости от тяжести заболевания могут быть назначены как местно (на поражённые участки кожи – лапы, голову, спину), так и системно.

 

Поражение грибком малассезия (Malassezia) у собак

Грибок Malassezia – это дрожжевой грибок, который в норме живёт на коже и в ушных каналах у собак. При снижении иммунитета у собаки ушной грибок начинает патологически размножаться, что может привести к развитию отитов и дерматитов. Развитию грибка в ушах у собаки также способствуют влажная воспалённая кожа, аллергии и гормональные нарушения. Наличию предрасположенности к развитию грибка также способствуют частые купания, висячие уши, хронические повреждения кожи.

Симптомы развития Malassezia. Это могут быть неспецифические повреждения кожи: эритемы, папулы, бляшки, расчёсы, шелушение кожи, плохой запах. Заметный симптом наличия у собаки ушного грибка, требующего лечения, — «не поддающийся терапии» наружный отит, причём необязательно, чтобы были одновременно поражены оба уха. Диагноз ставится с помощью соскоба кожи или исследования ушного секрета животного.

Лечение дрожжевого грибка малассезии у собак. Какими же способами нужно лечить ушной грибок у собак? Если есть другое серьезное заболевание, которое поспособствовало развитию грибка в ушах у собаки, прежде всего, необходимо именно его лечение. Параллельно проводятся местные обработки шампунями или кремами противогрибкового действия. В случае тяжёлого поражения для лечения грибка у собаки применяются системные препараты.

 

Кандидоз у собак

Кандидоз – грибковая инфекция у собак, которая характеризуется чрезмерным размножением дрожжевого грибка Candida albicans. В норме животное также может быть его носителем, развитие болезни произойдёт лишь при определённых условиях. Факторами риска развития кандидоза могут быть: снижение иммунитета, бесконтрольное применение антибиотиков, злокачественные образования, гормональные нарушения, наличие вирусных или бактериальных инфекций. Грибок также может начать размножаться на повреждённых участках кожи и слизистых.

Симптомы кандидоза. Кандида может поражать различные органы животного. При кожной инфекции хозяин может заметить обычные неспецифические симптомы: покраснение, шелушение, зуд, выпадение шерсти. Иногда возникают влажные дерматиты: развиваются папулы, которые затем лопаются. Кандидоз может поражать желудочно-кишечный тракт, что приводит к диарее. Грибок может также поражать различные слизистые, вызывая их воспаления: вагиниты, стоматиты. Диагноз ставится путём микроскопического исследования мазка поражённого участка кожи или слизистой.

Лечение кандидоза. В процессе лечения этой грибковой инфекции у собаки используются местные и системные противогрибковые препараты. Лечение может оказаться длительным, возможны рецидивы заболевания.

самое эффективное средство от грибка

самое эффективное средство от грибка

Ключевые слова: межпальцевый грибок эффективное лечение, заказать самое эффективное средство от грибка, эффективный раствор от грибка ногтей на ногах.

лечение грибка чайным деревом, лечение грибков в области, грибок на языке лечение, средство от грибка во влагалище, ламизил от грибка ногтей отзывы цена

средство от грибка во влагалище Хорошее средство от грибка ногтей на руках и на ногах стоит немало. Чтобы избежать ненужных трат и не запустить. Тем не менее, многие пациенты именно в этой категории находят самое эффективное для себя средство от грибка ногтей. Самые лучшие отзывы и рекомендации получили такие. Какие же таблетки от грибка наиболее эффективны? Однозначного ответа на этот вопрос нет, так как все таблетки. Самое дешевое лекарственное средство против грибка — таблетки Нистатина. Он входит в состав группы полиенов. Какие препараты эффективны при лечении грибка ногтей онихомикоза — рассказывали по ссылке. Все нижеперечисленные препараты отвечают таким требованиям. Это самые эффективные средства, отлично зарекомендовавшие себя в клинической практике. Несомненные достоинства мазей и кремов. Средства от грибков для ногтей на ногах и руках: лучшие противогрибковые препараты, действующие эффективно, ищите в статье с рейтингом антигрибковых гелей. Вконтакте. Facebook. Twitter. Google+. Одноклассники. Средства от грибка – собирательный термин, применяемый для обозначения нескольких категорий лекарственных и медикаментозных средств. Грибок является самым распространенным инфекционным заболеванием в мире, соответственно лекарств к нему существует немало. Эффективное средство от грибка ногтей на ногах — список препаратов. Средство эффективно против более 50 видов грибковых поражений. Продолжать лечение можно спреями, которые показывают. Таблетки от грибка на руках врач назначает в следующих случаях: Если поражена большая часть ногтевой пластины; При подногтевом гиперкератозе (чрезмерное разрастание клеток. Четыре лучших народных средства от грибка ногтей на видео: подробная инструкция и результаты применения. Эффективные рецепты ножных ванночек и натуральных мазей для лечения грибка ногтей в домашних условиях. Предлагаем Вам рассмотреть самые лучшие средства от грибка, составленный на основе отзывов потребителей. Эффективное противогрибковое средство на основе действующего вещества – кетоконазола. Грибком ногтей (онихомикоз) можно заразиться в бассейне или сауне, в спортивном зале и на пляже. Заболевание сопровождается сильным зудом и поражением кожи и ногтя. Постепенно болезнь приводит к тому, что ногтевая пластина разрушается. Избежать этого. ламизил от грибка ногтей отзывы цена вагинальный грибок лечение крем от грибка ногтей экзодерил

экзодерил капли от грибка ногтей отзывы как лечить грибок между пальцами ног масло нормафит цена межпальцевый грибок эффективное лечение эффективный раствор от грибка ногтей на ногах лечение грибка чайным деревом лечение грибков в области грибок на языке лечение

Поражение стоп и ногтей грибковой инфекцией знакомо многим. Но, не все люди, столкнувшиеся с данной проблемой, начинают своевременное лечение, и поэтому запускают болезнь. Как утверждает производитель, Нормафит от грибка снимет симптоматику, восстановит кожу, и предотвратит рецидив, если пройти полный курс терапии на любой стадии патологии. Нормафит – это безопасное и действенное средство при грибке ногтей, которое может использовать каждый. Но при покупке необходимо требовать у продавца сертификат качества, чтобы убедиться в том, что это не подделка. Некачественный препарат может быть опасен для здоровья, вызвав побочные эффекты. Разберемся, кто в реальных отзывах говорит правду. Изучим информацию о лекарстве Нормафит от производителя, а так же мнение специалистов о таком методе лечения микоза. Малассезия у собак: что это, лечение и профилактика заболевания, препараты. Грибковые инфекции – распространенная проблема в ветеринарии. Некоторые виды грибков, например, малассезия, являются условно патогенной микрофлорой эпидермиса. Содержание. Малассезия у собак – что это, пути. Малассезия – это дрожжевой грибок, который обитает на коже большинства собак. Малассезия поражает собак со сниженным иммунитетом. Выполнение оптимальных условий содержания и сбалансированное кормление предотвратят развитие грибка. К профилактическим мероприятиям следует отнести. Малассезия (Malassezia) — дрожжевой грибок, существующий на коже абсолютного большинства животных, включая собак, живущих в наших широтах. Лайки и северные олени счастливее в этом плане, так как холодный климат и отрицательную. Малассезия у собаки в запущенной форме. наличие длительной хронической персистенции грибка в организме. Лечение. Цель лекарственной терапии – подавление роста колоний малассезии и устранение всех факторов, которые могут способствовать её росту и длительной персистенции в организме. В окружающей среде существует множество живых микроорганизмов, которые тесно контактируют с людьми и животными. Многие виды грибков постоянно живут на кожных покровах. Дрожжевой грибок малассезия у собак: лечение при помощи лекарственных препаратов и профилактика инфекционного заболевания. Практически каждая собака может подвергнуться атаке возбудителей инфекций. Фото 20 Малассезионный дерматит у собак и кошек. Генерализованная алопеция с интенсивной эритемой, вызванная реакцией гиперчувствительности к грибкам, у собаки с выраженным Malassezia дерматитом, вторичным к аллергии. В окружающей среде существует множество живых микроорганизмов, которые тесно контактируют с людьми и животными. Многие виды грибков постоянно живут на кожных покровах. Лечение грибка малассезии у собак состоит из нескольких стадий: Первой стадией любого лечения является своевременное обращение за медицинской помощью. Чтобы лечение было эффективно необходимо создать среду враждебную для размножения грибка в местах распространения малассезии. Малассезия у собак это одна из разновидностей дрожжевого грибка, которая постоянно присутствует в организме. Лечение Малассезии у собак. После установления диагноза и определения области и степени грибкового поражения назначается комплексная медикаментозная терапия с целью ликвидации.

самое эффективное средство от грибка

Поскольку в составе натурального препарата более 30 природных компонентов, то масло не просто устраняет видимые признаки грибка. Формула эффективно борется с более серьезными причинами возникновения неприятного заболевания. Сразу после нанесения Normafeet быстро впитывается и начинает незамедлительную борьбу с грибком и его спорами. Это позволяет за один курс избавиться от всех неприятностей, которые раньше тревожили человека и заставляли стесняться собственных стоп. Симптомы грибка ногтей и пути заражения грибком. Традиционная медицина в лечении грибка. Грибок ногтей и его лечение уксусом, перекисью водорода, содой и солью, марганцовкой и йодом. Грибок ногтей на ногах: выявляем и лечим правильно. Такая неприятность как грибок на ногтях ног является частой патологией, которая при игнорировании лечения. После процедуры рекомендуется нанести на ногти оливковое масло. Ванна для ног с отваром календулы, чистотела, полевого хвоща или. Лечение грибка зависит от того, к какому виду он относится. Как вылечить грибок ногтей за неделю, знают только создатели рекламных роликов. При этом буфера и пилочки утилизируются после каждого использования, производится хирургическая стерилизация инструментов, для обработки ногтей используются. Грибок ногтей (онихомикоз) – это опасное заболевание, которое на ранней стадии может протекать с неявной симптоматикой. Грибковые заболевания способны не только разрушать поверхность ногтевой пластины. Начальная стадия грибка ногтей на ногах и руках имеет одни и те же симптомы. К сожалению, не. Чтобы предупредить эти осложнения, важно диагностировать и приступить к лечению онихомикоза в самом начале заболевания. Лечение грибка ногтей лаком, мазью, кремом, таблетками. Поэтому очень часто после лечения микозов болезнь возвращается. Наиболее распространенным видом таких недугов является грибок, поражающий кожу на ступнях, а также ногтевые поверхности. Болезнь очень заразна, а вот избавиться от нее подчас. Размножение грибков начинается с середины ногтя. Без лечения пластинки меняют цвет, начинают крошиться и отслаиваться. Грибок ногтей на ногах (фото представлены ниже), быстро распространяется и адаптируется к новым условиям. Подробнее рассмотрим основные факторы возникновения. У грибка на ногтях выраженные симптомы и признаки, фото и картинки начальной и запущенной стадии которых можно просмотреть. Самое эффективное лечение – комплексное. Лечение грибка ногтей включает в себя несколько форм препаратов, такие как мази, крема, таблетки, инъекции, народная медицина. Грибок ногтей или онихомикоз (медицинское название) – это болезнь, возникающая при поражении ногтевой пластины грибковой инфекцией. Онихомикозом страдает от 5 до 15 % людей. Особенности грибка ногтей и варианты лечения грибка. 110 фото грибков на ногах. Очень часто ногтевые пластины на пальцах ног страдают от разнообразных заболеваний. самое эффективное средство от грибка. вагинальный грибок лечение. Отзывы, инструкция по применению, состав и свойства. Мой отзыв о мази Тербинафин 1% будет очередным рассказом о том, какой же полезный все-таки сайт Отзовик. Мою маму уже много лет мучает грибок на коже между пальцами ног. Совсем его уже теперь не вылечить, но облегчить состояние можно. Противогрибковые средства довольно дорогие. Тербинафин избавил от грибка на пальцах ног. Все началось очень прозаично. Состав у них почти одинаковый,только та мазь разрекламированный бренд,. Хорошего дня! Недавно я писала отзыв на необычный презерватив Аризонский бульдог и он вызвал огромный ажиотаж. Поэтому я решила. Отзывы покупателей в Москве о препарате Тербинафин с действующим веществом Тербинафин. Грибка уже нет, но профилактически не грех помазать, постоянно ноги нужно в порядке содержать, так как хожу в общий душ на работе, то могу опять подцепить. Автор отзыва: Pavel. Дата отзыва: 18. Тербинафин (Terbinafine): 7 отзывов врачей, 8 отзывов пациентов, инструкция. Уже год живу без грибка. Особенно радует, что вылечил грибок между пальцев ног. Все мази и гели от грибка не работают, они не накапливаются в ногтевой пластине в отличие от Тербинафина. Любовь. 23.01.18 20:06:59. Читайте отзывы о применении препарата ТЕРБИНАФИН крем. Только честные и объективные отзывы о препарате на сайте. Неприятно пахнут ноги? Скорее всего, это грибок стопы! И есть НЕДОРОГОЕ средство избавления от этого недуга! Тербинафин супер выгодный аналог ЛАМИЗИЛ. Меня до какого-то. Отзывы принимавших препарат Тербинафин, читайте актуальные отзывы и заказывайте тербинафин по низким ценам на Ютека. Грибок на ногах – это еще пол беды. А вот пораженные грибком пальцы рук – вот это катастрофа. Вылечил 15- летний грибок ногтей на ногах за 3 месяца. Для надёжности ещё смазывал мазью от грибка. Уже не помню какой, но самой дешёвой. Но у меня подруга продвинутая, посоветовала поискать на форумах реальные отзывы. назначил врач от грибка, соскоб выявил нити мицелия на пальце ноги. врач сказал, что лечить ноготь кремом от грибка — это миф, нужно пить таблетки. на мое уточнение, что печень больная, описторхоз много лет лечила, сказал, вам выбирать, лечиться или нет, лечение будет 7 месяцев. Анонимно. Екатеринбург. Тербинафин — скажи грибку твердое нет!. В какой-то момент заметила, что пальцы на левой ноге побелели. Так, что таблетки Тербинафин и такая же мазь помогли очень хорошо. Тербинафин. Рейтинг 5 из 5 на основании 6 отзывов. Противогрибковые. Мне от грибка на большом пальце ноги назначили противогрибковую мазь и разовый прием таблетки, которая должна. И в результате быстро забыла о грибке, надеюсь, что навсегда.Крем тербинафин от грибка ногтей отзывы Тербинафин Действующие вещества: Тербинафин (Terbinafine) Состав.

Грибковые заболевания у собак — Royal Canin

Грибковые инфекции, или дерматофитозы собак — довольно распространенная причина обращения владельцев к ветеринарному врачу. Грибковые заболевания могут поражать собак любой породы и в любом возрасте. К сожалению, нельзя дать полной гарантии, что питомец не заболеет каким-либо видом грибка даже при хороших условиях содержания.

Несомненным плюсом в этой ситуации являются современные препараты, с помощью которых грибковые инфекции поддаются лечению. Но главные условия успеха — профилактика, своевременное обращение в ветеринарную клинику при первых симптомах заболевания, правильная диагностика и вовремя начатое лечение.

Основное внимание владельцев должно быть направлено на профилактику грибковых заболеваний, так как чаще всего они передаются при тесном контакте с зараженными животными. Нужно выбирать места для выгула и следить за контактами собаки, не допуская ее общения с бездомными животными или нахождения в местах их скопления. Споры грибка с улицы может принести на обуви и сам владелец, поэтому нужно следить за чистотой и порядком в доме.

Более подвержены заболеваниям грибковыми инфекциями молодые и ослабленные собаки. К примеру, неопасные дрожжевые грибки относятся к виду условно патогенных и постоянно присутствуют на коже. Но при благоприятных для инфекции условиях — болезнь, общее ослабление иммунитета, процесс выздоровления — количество грибка увеличивается, что вызывает такое заболевание, как малассезия. Значит, причина заболевания связана с состоянием здоровья собаки. Регулярные осмотры и профилактические мероприятия — прививки, антипаразитарные обработки — помогут снизить риск появления грибковых заболеваний. Своевременное обращение к врачу при первых признаках заболевания и вовремя начатое лечение также помогают решить эту проблему.

Спровоцировать развитие грибковой инфекции может и неправильное кормление, слишком высокая влажность, плохая гигиена собаки. Грибок особенно хорошо размножается в теплой и влажной среде, к примеру, в непросушенной и нечесаной шерсти, под свалявшимися колтунами, на лапах, на сгибах конечностей, в ушах. Гигиена собаки и уход за ней, правильно подобранный рацион питания могут решить многие проблемы со здоровьем животного. Поэтому профилактика любых заболеваний, в том числе и грибковых, начинается именно с правильного, ответственного отношения владельца к своему питомцу.

Если состояние кожи и шерсти собаки вызывает подозрение, появились признаки заболевания — пятна на коже, активное выпадение шерсти, зуд, покраснения, высыпания, мокнущие или шелушащиеся участки, — нужно сразу же обратиться в ветеринарную клинику. Дело в том, что, попав в благоприятную среду, грибковая инфекция начинает очень быстро размножаться, тем самым еще больше снижая иммунитет собаки. При отсутствии своевременной диагностики и лечения грибок может затронуть не только поверхностные, но и глубокие слои кожи и как следствие привести к осложнениям — развитию гнойных воспалений и фолликулезу. Кроме того, собака становится заразной для окружающих животных, а в некоторых случаях и для человека.

Лечение грибковых инфекций начинается с визита к ветеринарному врачу и тщательного осмотра. Чтобы диагностировать заболевание, нужно сначала выяснить, каким видом или видами грибковой инфекции заражено животное. Для этого врач осматривает собаку с помощью лампы, обязательно берет соскобы кожи и частички шерсти, так как только полный анализ поможет определить вид грибка, его количество, чувствительность к препаратам и скорость роста. Также необходимо сделать бактериологический посев, так как грибок может оказаться вторичной инфекцией. Чтобы выяснить уровень иммунитета и общее состояние организма, нужно будет сделать развернутый биохимический анализ мочи и крови. То есть врач должен понять, в чем причина заболевания. И только после этого он сможет назначить необходимую схему лечения. Такое количество анализов с лихвой окупит потраченное время и средства.

Правильно подобранные препараты не просто ослабляют действие инфекции, а полностью избавляют собаку от заболевания. Врач, как правило, назначает не только внутренние препараты в виде таблеток или уколов, но и внешнюю обработку ссадин, высыпаний и пятен с помощью мазей. В этом случае ни при каких условиях нельзя нарушать дозировку препаратов и схему приема, так как все противогрибковые мази и шампуни токсичны. Параллельно с этим врач назначает иммуностимуляторы, иммуномодуляторы и гепатопротекторы. Важно помнить, что чем раньше начато лечение собаки, тем оно эффективнее.

Малассезиозный дерматит

Что такое малассезия?

Malassezia — это виды дрожжей, которые колонизируют поверхностные слои кожи у здоровых собак и кошек. Они имеют взаимовыгодные отношения со многими видами бактерий, которые также колонизируют поверхность кожи. Наиболее распространенным видом, обнаруживаемым у собак и кошек, является Malassezia pachydermatis, и он обычно встречается на коже, в ушных каналах и на слизистых оболочках (оральных, анальных, вагинальных) нормальных собак и кошек.Подавляющему большинству животных эти дрожжевые организмы не причиняют вреда. Однако, когда количество увеличивается, может возникнуть воспаление кожи.

Почему Malassezia иногда вызывает заболевание?

Существует ряд теорий, объясняющих, почему обычно безвредные дрожжевые грибки приводят к кожным заболеваниям (дерматитам). Вероятно, это связано с повышенной влажностью, поскольку малассезиозный дерматит чаще встречается во влажном климате и в определенных анатомических местах, таких как слуховые проходы и кожные складки. Увеличение количества питательных веществ и факторов роста для дрожжей также, вероятно, связано с тем, что животные с сопутствующими шелушащимися и жирными кожными заболеваниями, гормональными заболеваниями и аллергическими кожными заболеваниями чаще страдают от этой проблемы. Кроме того, некоторые породы собак кажутся особенно восприимчивыми к малассезиозному дерматиту, поэтому генетика также может сыграть свою роль. Породы, такие как бассет-хаунды, американские кокер-спаниели, боксеры и вест-хайленд-уайт-терьеры, по-видимому, подвержены более высокому риску заболевания. Среди кошек особенно восприимчива порода девон-рекс.

Какое воздействие оказывает малассезия на собак и кошек?

Малассезиозный дерматит — распространенная проблема у собак. Он обычно проявляется зудом, шелушением и воспалением кожи в таких местах, как губы, слуховые проходы, шея, подмышки, между пальцами ног и в складках кожи вокруг лица (рис. 1 и 2).Многие собаки испытывают жирную кожу с неприятным характерным запахом. Когда дерматит присутствует в течение некоторого времени, кожа утолщается и часто темнеет из-за чрезмерной пигментации. Инфекция Malassezia также может привести к красновато-коричневому обесцвечиванию когтей.

Рисунок 1: Собака с малассезиозным дерматитом на шее и передних конечностях

 

Рисунок 2: Кожа межпальцевых контактов собаки с дерматитом Malassezia

 

Малассезиозный дерматит — редкое заболевание у кошек. Когда он присутствует, он часто вызывает зуд, шелушение и воспаление кожи в ушных каналах, складках кожи лица, когтях и подбородке. В некоторых случаях это может проявляться генерализованным жирным и чешуйчатым дерматитом, который часто является вторичным по отношению к серьезному внутреннему заболеванию. Кошки с этим проявлением должны пройти обширные исследования для поиска основной причины.

Как диагностируется малассезия?

Клинические признаки малассезиозного дерматита могут быть похожи на целый ряд других кожных заболеваний.По этой причине диагноз не может быть поставлен без проведения тестов. Наиболее полезным тестом для выполнения является взятие образца мазка или липкой ленты (оттиск ленты) с кожи для окрашивания и исследования под микроскопом. Это позволяет исследовать материал с поверхности кожи и оценить количество микробов на коже. Поскольку микроорганизмы Malassezia присутствуют у нормальных здоровых животных, обнаружение небольшого количества или случайных дрожжевых грибков не имеет значения. Однако в случаях малассезиозного дерматита дрожжевые грибки могут присутствовать тысячами и часто связаны с воспалительными клетками.Malassezia выглядят под микроскопом как структуры в форме арахиса и обычно имеют пурпурно-синий цвет из-за окрашивания, используемого для исследования (рис. 3 и 4).

Рисунок 3. Вид дрожжей Malassezia в форме арахиса под микроскопом в случае малассезиозного дерматита

 

Рисунок 4. Дрожжевые организмы в форме арахиса под микроскопом при дерматите, вызванном Malassezia

 

Как лечится малассезиозный дерматит?

Лечение дерматита, вызванного Malassezia, направлено на снижение числа дрожжевых грибков до нормального уровня.Также жизненно важно устранить любые основные причины, по которым количество дрожжей увеличилось в первую очередь. Доступны различные продукты для местного применения, которые являются препаратами выбора для пациентов, соблюдающих режим лечения. Противогрибковые шампуни являются основой лечения малассезиозного дерматита, поражающего кожу, и обычно очень эффективны. Когда мытье шампунем невозможно, эффективными могут быть противогрибковые салфетки, ополаскиватели и кремы. Противогрибковые препараты также являются распространенными компонентами лечебных ушных капель для собак и кошек с инфекциями Malassezia в ушах.

В редких случаях для лечения малассезиозного дерматита может потребоваться прием пероральных препаратов. Эти препараты не лицензированы в Великобритании для лечения Malassezia у собак или кошек, поэтому их следует зарезервировать для случаев, когда другие методы лечения не реагируют.

Повторение проблемы очень распространено, если основной триггер не был идентифицирован и исправлен.

Если у вас есть какие-либо вопросы или проблемы, пожалуйста, не стесняйтесь обращаться к нам.

Оформление направления для вашего питомца

Если вы хотите направить своего питомца к одному из наших специалистов, посетите нашу страницу «Организация направления ».

 

© Copyright North Downs Specialist Referrals

 

Грибковая инфекция (Malassezia pachydermatis) кожи у собак

Малассезиозный дерматит у собак

Malassezia pachydermatis — дрожжевой грибок, обнаруживаемый на коже и ушах собак. Несмотря на то, что это нормальный обитатель этих регионов, аномальный разрастание дрожжей может вызвать дерматит или воспаление кожи. Точные причины этого заболевания пока не известны, но его связывают с аллергией, себореей и, возможно, врожденными (врожденными) и гормональными факторами.

Малассезиозный дерматит может поражать любую породу собак, но следующие породы предрасположены к этому заболеванию: пудели, бассет-хаунды, вест-хайленд-уайт-терьеры, кокер-спаниели и таксы.

Симптомы и типы

  • Раздражение кожи
  • Потеря волос (алопеция)
  • Сальность
  • Чешуйчатая кожа
  • Покраснение пораженных участков
  • Зловонные выделения из очагов поражения
  • Участки потемнения кожи (гиперпигментация) и утолщение эпидермиса (видно в хронических случаях)

Причины

Высокая влажность и температура могут увеличить частоту случаев заболевания. Другие факторы, которые могут быть предрасполагающими факторами к этому заболеванию гиперчувствительности, включают сопутствующие инфекции и пищевую аллергию и аллергию на блох. Генетические факторы также подозреваются в начале заболевания у предрасположенных пород собак в молодом возрасте.

Диагностика

Вам нужно будет подробно рассказать ветеринару о состоянии здоровья вашей собаки, в том числе о появлении и характере симптомов. Затем он или она проведет полное медицинское обследование, а также биохимический профиль, анализ мочи и общий анализ крови — результаты которых обычно нормальны, если у собаки нет сопутствующего заболевания.

Более специфическое тестирование включает культуру возбудителя, а также взятие небольшого образца кожной ткани для цитологического исследования кожи.В этом тесте ваш ветеринар прикоснется стерилизованным ватным тампоном к пораженному участку и окрасит его красителем Diff-Quik на предметном стекле. После окрашивания предметное стекло исследуют под микроскопом, чтобы продемонстрировать присутствие дрожжей в образце. Это поможет ему или ей идентифицировать возбудитель.

Лечение

Для лечения этого состояния используются различные терапевтические средства, но конечной целью является уменьшение количества дрожжей и бактерий. Ваш ветеринар предложит лекарства для нанесения на кожу, а также порекомендует лечебные шампуни, которые должны помочь удалить чешуйки и избавиться от неприятного запаха.Сопутствующие бактериальные инфекции лечат антибиотиками и антибактериальными шампунями.

Жизнь и управление

Вам нужно будет регулярно посещать ветеринара вашей собаки для оценки болезни и прогресса лечения. При каждом посещении ветеринарный врач будет осматривать вашу собаку и выполнять цитологическое исследование кожи, чтобы подтвердить, что количество возбудителя уменьшается. Раздражение кожи и неприятный запах обычно исчезают в течение одной недели лечения; тем не менее, рецидив заболевания является обычным явлением, когда основные условия не вылечены.

Строго следуйте инструкциям и применяйте местные лекарства в соответствии с предписаниями. Не используйте шампунь или лекарства и не изменяйте лечение вашей собаки без консультации с ветеринаром. Поскольку рецидив является обычным явлением, наблюдайте за своей собакой на предмет любых неблагоприятных симптомов и позвоните своему ветеринару, если вы подозреваете рецидив.

См. также

Malassezia (дрожжевой) дерматит Джуди Зельцер, BVetMed, MRCVS, DACVD

История вопроса
Малассезиозный дерматит и отит чаще всего возникают у животных с аллергией, эндокринопатиями (гипотиреоз, болезнь Кушинга), иммуносупрессивными заболеваниями и другими кожными заболеваниями.Наиболее распространенным возбудителем является Malassezia pachydermatis . Обнаружение небольшого количества этих организмов у кошек, собак и даже людей является нормальным явлением. Тем не менее, перенаселенность является обычным явлением, когда нормальный кожный барьер нарушен.

Собаки любого возраста, породы и пола могут быть поражены дрожжевым дерматитом. Кожные факторы, предрасполагающие к Malassezia , включают тепло, сырость, повышенную влажность, чрезмерные кожные складки, ожирение и воспаление кожи или ушей. Часто поражаемые породы включают вест-хайленд-уайт-терьеров, бассет-хаундов, кокер-спаниелей, спрингер-спаниелей и китайских шарпеев. Другие состояния, которые могут быть связаны со вторичными дрожжевыми инфекциями, включают эндокринопатии (гипотиреоз, гиперадренокортицизм) и иммуносупрессию (неоплазия, животные на химиотерапии). Хотя дрожжевой дерматит встречается реже, чем у собак, он может возникать у кошек, особенно у персидских кошек или кошек с сопутствующими заболеваниями внутренних органов. Malassezia  не считается заразным для других животных или людей; однако есть очень редкие сообщения о том, что люди с ослабленным иммунитетом подвергаются большему риску заражения.

Клинические признаки
Дрожжевые инфекции могут быть локализованными (уши, перианальная область, складки кожи лица, межпальцевые промежутки) или иметь более генерализованное проявление. Пораженные животные часто зудят, и их можно обнаружить облизывающими и жующими пораженные участки. Степень зуда не всегда коррелирует с реальной тяжестью инфекции. Некоторые животные имеют меньшее количество дрожжевых организмов, но страдают повышенной чувствительностью к этим организмам. Кожа пораженных животных обычно эритематозная, может иметь желтые корки и шелушение, со временем может стать гиперпигментированной и лихенифицированной.Области тела, обычно поражаемые у собак, включают ступни, когти, нижнюю часть шеи, подмышечные впадины, живот, ноги и под хвостом. У кошек дрожжевые инфекции могут поражать подбородок или лицо, ногти или иногда другие участки тела.

Диагностика
Malassezia обычно диагностируется с помощью цитологического исследования кожи или уха. Образцы берут, прижимая предметное стекло к коже, используя ватные тампоны или ацетатную ленту, или выполняя соскоб сухой кожи лезвием.После окрашивания Diff-Quik предметное стекло можно исследовать под микроскопом при увеличении 1000x (под маслом). Несколько дрожжевых организмов (1-2 дрожжевых организма на поле микроскопа), обнаруженные на коже или ухе, обычно считаются нормальными. Однако большее количество микроорганизмов в сочетании с эритемой, раздражением и зудом считается ненормальным. Кроме того, очень важны выявление и лечение основной причины дрожжевой инфекции, а другие методы диагностики могут включать пробную терапию чесоточного клеща, пробную гипоаллергенную диету, тестирование на аллергию, анализ крови на гормональные заболевания или биопсию кожи.

Лечение
Лечение Malassezia дерматита обычно включает местную терапию противогрибковыми шампунями, спреями, салфетками и лосьонами и/или системное лечение кетоконазолом, флуконазолом, итраконазолом или тербинафином. Использование только местных продуктов может быть достаточным для лечения легких или локализованных инфекций. Пероральные препараты рекомендуются при более тяжелых или генерализованных инфекциях. Некоторые инфекции требуют длительной терапии для достижения наилучших результатов.Иногда пульс-терапия (терапия используется только в определенные дни недели) необходима для лечения пациентов с хроническими дрожжевыми инфекциями. Большинству животных также потребуются пероральные антибиотики для лечения сопутствующих бактериальных кожных инфекций. Лечение основной причины также очень важно и может включать пробную терапию от паразитов, гипоаллергенную диету, гипосенсибилизирующие инъекции, основанные на тестах на аллергию, или терапию любого основного гормонального или внутреннего заболевания.

Прогноз
Прогноз при дрожжевом дерматите благоприятный при условии выявления и лечения основной причины.Некоторые животные не излечиваются, но их контролируют с помощью прерывистой местной или системной противогрибковой терапии.

Judy Seltzer, BVETMED, MRCVS, DACVD

3 Медицинский центр

3 75 Sunrise Highway

3 West Islip , Нью-Йорк 11795
(631) 587-0800; факс (631) 587-2006

https://www.vmcli.com

Малассезиозный дерматит у собак | EMBRACE

Резюме

Malassezia pachydermatitis — это название вида дрожжей, которые обычно обитают на поверхности кожи собак. При наличии аллергического заболевания кожи или любого другого воспалительного заболевания кожи этот микроорганизм имеет тенденцию к аномальному размножению. Восковая, жирная, шелушащаяся и/или влажная кожа, в том числе кожа, выстилающая слуховой проход, особенно предрасположена.

В 50% случаев инфекция Malassezia является вторичным болезненным процессом. Но у некоторых пород повышенная чувствительность к этому дрожжевому организму (вероятно, результат аберрантного иммунного ответа) может вызвать первичную версию, которая подозревается в наличии наследственной предрасположенности неизвестного происхождения.

Симптомы и идентификация

Результатом чрезмерного роста Malassezia является кожная инфекция с неприятным запахом, которая имеет тенденцию вызывать сильный зуд. Шелушение, сухость, жирность и влажная кожа являются общими признаками, которые могут быть первичным или вторичным результатом заражения организмом Malassezia.

Обычно больше всего поражаются уши, лицо, живот, подмышки и/или ступни. Ушные инфекции, вызываемые Malassezia, вызывают тряску головы, боль и выделения из уха (уха).

Диагностика инфекции Malassezia осуществляется просто с помощью цитологии (микроскопическая оценка клеток, присутствующих на поверхности пораженной кожи).Чтобы дифференцировать первичную и вторичную инфекцию Malassezia, исключают все основные причины. Другими словами, первичный дерматит Malassezia — это диагноз, поставленный путем исключения всех других возможностей.

Пораженные породы

Эти породы имеют более высокий риск чрезмерного роста Malassezia и/или повышенной чувствительности:

Лечение

Лечение состоит из местной и системной терапии противогрибковыми препаратами. Частого мытья головы и применения других местных препаратов может быть достаточно, но во многих тяжелых случаях требуются пероральные противогрибковые препараты.

Лечение любых основных болезненных процессов является обязательным, но в случаях первичного малассезиозного дерматита медикаментозная терапия (местная или системная) считается единственной линией защиты.

Ветеринарные расходы

Стоимость лечения первичного дерматита, вызываемого Malassezia, относится к расходам на лекарства и лечебные шампуни и/или другие методы лечения, необходимые для борьбы с разрастанием организма. Расходы, связанные с вторичным дерматитом Malassezia, будут варьироваться в зависимости от провоцирующей причины.

Профилактика

Хотя генетическое происхождение этого состояния недостаточно изучено, общепринято, что собак с диагнозом первичного дерматита Malassezia не следует разводить. Управление размножением — единственный известный способ профилактики.

Ссылки

OFA

Scott, D.W., Miller, WH, Griffin, CE 1995. Muller and Kirk’s Small Animal Dermatology. стр. 351-357. В.Б. Сондерс Ко, Торонто.

Malassezia Dermatitis (дрожжевые инфекции) у собак: причины, лечение, профилактика

Малассезиозный дерматит — очень распространенное кожное заболевание, также известное как дрожжевой дерматит.Это вызвано грибком Malassezia pachydermatis , наличие которого на коже является нормальным явлением. Проблемы возникают только тогда, когда он чрезмерно разрастается и приводит к воспалению кожи, более известному как дерматит. Это состояние может вызывать сильный зуд у вашей собаки и требует длительного лечения, хотя большинство собак быстро выздоравливают, и зуд должен уменьшиться в течение первой недели лечения.

Как собаки заражаются малассезиозным дерматитом?

Изображение предоставлено: ThamKC, Shutterstock

Грибок Malassezia присутствует на коже собак и в нормальных условиях никогда не вызывает проблем.Однако, если иммунная система пострадает, этот грибок может воспользоваться возможностью, которую ослабленная иммунная система представляет для заражения. Это позволяет грибку размножаться, создавая дрожжевую инфекцию. Инфекции такой природы известны как оппортунистические инфекции.

Иногда иммунная система может быть подавлена ​​лекарствами, которые принимает собака, например кортикостероидами. У других собак может быть иммунодефицит, который плохо справляется с дрожжевой инфекцией. К счастью, дрожжевой дерматит не заразен, так что это не то, чем ваша собака заразилась от другой или может заразиться.

Некоторые породы собак чаще страдают дрожжевым дерматитом, чем другие.

Породы, которые считаются наиболее подверженными этому заболеванию, включают:

Общие признаки дрожжевого дерматита

Знание признаков дрожжевого дерматита может помочь вам выявить его на ранней стадии и начать лечение.

Наиболее распространенные признаки этого состояния включают:

  • Зуд
  • Красная кожа
  • От собаки исходит затхлый запах
  • Повышенный темный пигмент кожи
  • Хронические инфекции уха
  • Кожа становится толстой
  • Хрустящая, шелушащаяся кожица с чешуйками

Диагностика малассезиозного дерматита

Изображение предоставлено: TamaraLSanchez, Shutterstock

. Ваш ветеринар может диагностировать это состояние кожи, взяв образец кожи и изучив его под микроскопом.

Есть несколько способов взять этот образец кожи, например:

  • Биопсия кожи . Это наиболее инвазивный вариант, но он также предоставляет наиболее полную диагностическую информацию. Для биопсии кожи используется перфоратор для биопсии, который берет небольшой кусочек кожи.
  • Ватный тампон Образец — смоченным ватным тампоном протирают кожу, чтобы собрать дрожжи для исследования.
  • Мазок-оттиск – Предметное стекло микроскопа прижимается непосредственно к коже собаки для сбора образцов дрожжей.
  • Подготовка ацетатной ленты – К коже приклеивается кусок прозрачной ленты. Образцы дрожжей прилипают к ленте после удаления.
  • Соскоб кожи – острое лезвие используется для соскоба верхнего слоя кожи вместе с образцами дрожжей, которые будут исследованы.

Лечение дрожжевого дерматита

Изображение предоставлено: prasert phoomiekasak, Shutterstock

. В зависимости от того, насколько серьезна инфекция дерматита у вашей собаки, она может получать лечение в виде пероральных препаратов, местного лечения или их комбинации.

Пероральные препараты

Пероральные препараты, как правило, используются в наиболее тяжелых и повторяющихся случаях малассезиозного дерматита. Антибиотики также могут потребоваться для лечения бактериальных инфекций кожи, которые обычно сопровождают дерматит. Лечение пероральными препаратами длится несколько месяцев. При использовании таких лекарств требуется тщательный мониторинг крови вашей собаки, поскольку они имеют серьезные потенциальные побочные эффекты.

Местное лечение

Лечебные шампуни обычно используются для местного лечения дрожжевого дерматита.Если у вашей собаки особенно жирная кожа, возможно, потребуется вымыть ее шампунем с перекисью бензоила или сульфидом селена, чтобы удалить жир, прежде чем купать противогрибковый шампунь с кетоконазолом, хлоргексидином или миконазолом в качестве активного ингредиента. .

При мытье противогрибковым шампунем важно, чтобы шампунь оставался на коже не менее 10 минут. Лечение необходимо будет повторять два раза в неделю в течение 12 недель, в зависимости от тяжести и стойкости инфекции.

Заключение

Дрожжевой дерматит или дерматит Malassezia, как это известно с научной точки зрения, представляет собой грибковую инфекцию кожи, которая возникает, когда иммунная система собаки подвергается риску. Он может варьироваться по степени тяжести от легкой до крайней степени и, по-видимому, влияет на одни породы больше, чем на другие. Лечение может принимать форму пероральных препаратов или противогрибковых шампуней, хотя собакам с тяжелым дрожжевым дерматитом, скорее всего, потребуется и то, и другое. Это очень поддающееся лечению состояние, но если его не лечить, оно может серьезно повлиять на качество жизни вашей собаки.


Авторы избранных изображений: Kittima05, Shutterstock

МАЛАССЕЗИЙНЫЙ ДЕРМАТИТ | Зоэтис CA

Clinical Knowledge Insight, созданный Дженнифер Прендерграфт. ДВМ. ДАКВД.

  • Поверхностный эпидермальный разрастание комменсальных дрожжей, Malassezia pachydermatis .
  • Распространенный диагноз у собак, редко встречается у кошек, но, возможно, не диагностируется у этого вида.
  • Другие виды рода Malassezia признаны комменсалами собак и кошек, но, по-видимому, гораздо реже вызывают дерматит.
  • Malassezia дерматит развивается вторично по отношению к аллергическим, эндокринным, конформационным нарушениям и нарушениям кератинизации и редко развивается из-за иммунодефицита.
  • Повышенная температура и влажность окружающей среды и защищенные кожные микроокружения, такие как кожные складки и слуховые проходы, по-видимому, являются предрасполагающими факторами для колонизации Malassezia .
  • Malassezia не является инвазивным организмом и остается ограниченным роговым слоем.Ферменты, продуцируемые Malassezia , стимулируют зуд и воспалительные изменения.
  • Повышенная чувствительность к Malassezia считается потенциальной причиной значительного зуда и может чаще возникать у собак и кошек с атопическим дерматитом, как и у людей, страдающих атопией.
  • Распространен одновременный избыточный рост видов Staphylococcus .
  • Бассет-хаунды, вест-хайленд-уайт-терьеры и американские кокер-спаниели перепредставлены, а также кошки девон-рекс и сфинкс.
КАК ЭТО ВЫГЛЯДИТ?

Malassezia наружный отит, вторичный по отношению к атопическому дерматиту (собачьих)

Malassezia наружный отит, вторичный по отношению к атопическому дерматиту (собачьих)

Лихенификация и сальная себорея, вызванная Malassezia, связанной с атопическим дерматитом (собачьи)

Эритема и жирная себорея, вызванная Malassezia, связанной с атопическим дерматитом (собачьи)

Эритема и жирная себорея, вызванная Malassezia, связанной с атопическим дерматитом (собачьи)

Эритема с лихенизацией и жирной себореей, вызванной Malassezia (собачий)

Перивульварная эритема и жирная себорея, вызванная Malassezia (собачий)

Малассезиозный дерматит когтеобразных складок (девон-рекс)

Malassezia пододерматит у собаки (собака)

Malassezia наружный отит, вторичный по отношению к атопическому дерматиту (собачьих)

Malassezia наружный отит, вторичный по отношению к атопическому дерматиту (собачьих)

Malassezia наружный отит, вторичный по отношению к атопическому дерматиту (собачьих)

  • Клинические признаки неспецифичны и могут включать:
    • Зуд
    • Неприятный запах
    • Эритема
    • Весы
    • Сальные или восковые остатки кожи
    • Поражения, соответствующие самотравме из-за зуда
    • Гиперпигментация и лихенификация
    • Ржавчина или коричневая пигментация волос или проксимальной части когтя (с вовлечением когтевого валика)
    • Кошачьи прыщи на подбородке
  • Обычные локализации включают:
    • Ушные каналы
    • Края и складки губ
    • Подмышечная впадина
    • Пах
    • Вентральная шейка
    • Промежность
    • Межпальцевые промежутки и когтевые складки
    • Кожные складки (т. г., лицевые складки английских бульдогов и др.)
  • Важно отметить, что инфекции Staphylococcus и связанные с ними поражения часто присутствуют одновременно.
С одного взгляда ЧТО ЕЩЕ НА ЭТО ВЫГЛЯДИТ?
  • Стафилококковая пиодермия
  • Демодекоз
  • Дерматофитоз
  • Хейлетиеллез
  • Саркоптоз
  • Гипотиреоз собак
  • Синдромы гиперчувствительности: гиперчувствительность к укусам блох, кожная неблагоприятная пищевая реакция, атопический дерматит и контактная гиперчувствительность
  • Первичные нарушения кератинизации
  • Эпителиотропная кожная лимфома

Важно отметить, что дерматит Malassezia может присутствовать одновременно с вышеупомянутыми дифференциальными диагнозами.

КАК ЭТО ВЫГЛЯДИТ? КАК ЭТО ДИАГНОСТИРОВАТЬ?
  • Диагноз подтверждается цитологическим исследованием кожи.
  • Хотя неприятный запах является обычным явлением, его наличие или отсутствие может вводить в заблуждение. Цитологическое исследование настоятельно рекомендуется.
  • Численность микроорганизмов Malassezia варьируется.
  • Обнаружение более 3 дрожжевых грибков на иммерсионное поле при высоком увеличении является важным при наличии подозрительных клинических признаков.
  • Клинические признаки могут присутствовать при меньшем количестве дрожжей у некоторых людей.
  • Положительные реакции на внутрикожно введенный антиген Malassezia или повышенные уровни Malassezia -специфического IgE подтверждают диагноз гиперчувствительности Malassezia у зудящих пациентов с избыточным ростом Malassezia . Эта диагностика не проводится рутинно и не требуется для постановки диагноза.
ЧТО ЕЩЕ НА ЭТО ВЫГЛЯДИТ? КАК С ЭТИМ УПРАВЛЯТЬ?
  • Лечение включает лечение основного заболевания, а также местную и/или системную противогрибковую терапию.
  • Повторную проверку с повторным цитологическим исследованием следует проводить через 1–3 недели после начала терапии и примерно через неделю после клинического и цитологического излечения.
  • Типичная продолжительность лечения составляет 3-4 недели.
  • Местная терапия показана во всех случаях малассезиозного дерматита и должна использоваться в сочетании с системной терапией при генерализованных проявлениях.
    • Шампунь лучше всего проводить 2-3 раза в неделю.Шампуни следует продолжать до разрешения, и их можно использовать еженедельно, чтобы предотвратить рецидив. Рекомендуемое время контакта не менее 10 минут.
    • Эффективные активные ингредиенты включают: кетоконазол 1–2%, миконазол 2%, хлоргексидин 2–4%, бензоилпероксид 2,5% и сульфид селена 1%.
    • Спреи и салфетки, содержащие уксусную кислоту 2 % и борную кислоту 2 %, хлоргексидин 2–4 %, миконазол 2 % или кетоконазол 1–2 %, можно использовать каждые 24–48 часов до исчезновения симптомов, и их можно поддерживать 1–2 раза. еженедельно для профилактики рецидивов.
    • Несмываемые ополаскиватели со следующими активными ингредиентами можно использовать в качестве единственного или дополнительного местного средства: уксусная кислота 2%, кетоконазол 1–2%, миконазол 2% и хлоргексидин 2–4%. Раствор белого уксуса и воды (1:3) можно использовать в качестве несмываемого ополаскивателя с уксусной кислотой.
  • Очаговые, сухие проявления можно лечить ежедневным применением противогрибковых лосьонов, мазей или кремов.
    • Активные ингредиенты включают: клотримазол 1%, миконазол 1-2%, тербинафин 1%, тиабендазол 4%, амфотерицин В 3% и нистатин.
  • Системное противогрибковое лечение рекомендуется для пациентов с генерализованной или многоочаговой колонизацией Malassezia и может использоваться в качестве единственной терапии при плохой приверженности местной терапии.
  • Системная терапия подобрана опытным путем. Посев и определение чувствительности Malassezia в лабораториях обычно не проводятся, а надежные воспроизводимые пограничные значения чувствительности еще предстоит установить и коррелировать с клинической эффективностью.
  • Типичная продолжительность лечения составляет 3-4 недели. Повторная проверка рекомендуется для оценки клинического и цитологического ответа.
ЛЕКАРСТВА ДОЗЫ
Кетоконазол

5-10 мг/кг перорально каждые 24 часа

Итраконазол

5-10 мг/кг перорально каждые 24 часа или 2 дня подряд в неделю

Флуконазол

10 мг/кг перорально каждые 24 часа

Тербинафин

30 мг/кг перорально каждые 24 часа или 2 дня подряд в неделю

  • Кетоконазол и итраконазол следует принимать во время еды для оптимизации всасывания.
  • Противогрибковые средства класса азолов могут вызывать гепатотоксичность, и их следует избегать или использовать с осторожностью у пациентов с гепатотоксичностью. Возможны многие лекарственные взаимодействия с этим классом, и следует оценить сопутствующие лекарства. При длительном применении противогрибковых препаратов класса азолов целесообразно провести биохимический анализ сыворотки для оценки гепатотоксичности.
  • Васкулит и кожная язва могут развиться у 7,5% собак, получавших итраконазол в дозах ≥10 мг/кг.
  • Антигены Malassezia могут быть включены в иммунотерапевтические препараты для пациентов с атопическим дерматитом.В настоящее время отсутствуют доказательства эффективности иммунотерапии у пациентов с подозрением на гиперчувствительность к Malassezia .
КАК ЭТО ДИАГНОСТИРОВАТЬ? КОММЕНТАРИИ
  • Наиболее частыми причинами неэффективности лечения являются неадекватная продолжительность лечения и неспособность контролировать основное дерматологическое заболевание.
  • У пациентов с атопическим дерматитом местная поддерживающая терапия, особенно в складках и межпальцевых промежутках, полезна для предотвращения рецидивов и лечения сопутствующего зуда.
  • Malassezia с in vitro была зарегистрирована резистентность к кетоконазолу, флуконазолу и интраконазолу. Однако устойчивость к in vivo недостаточно документирована.

Каталожные номера

  • Фой Д.С., Трепанье Л.А. Противогрибковое лечение ветеринарных больных мелких животных. Vet Clin North Am Small Anim Pract . 2010 г.; 40: 1171-88
  • Наттолл Т. Харви Г. Маккивер.Пи Джей. Кожные болезни собак и кошек. 2009.59.
КАК С ЭТИМ УПРАВЛЯТЬ?

Отдельный отек, содержащий гнойный материал, обычно в подкожной клетчатке

Перианальный абсцесс у собаки

Отсутствие волос на участках, где они обычно присутствуют; может быть связано с фолликулитом, аномальным циклом фолликулов или самотравмой

Обширная алопеция, вторичная по отношению к кожной эпителиотропной лимфоме

хорошо очерченная, циркулярная, пятнистая или сливающаяся алопеция, часто связанная с фолликулитом

Алопеция «поеденная молью», вторичная по отношению к поверхностному бактериальному фолликулиту

Регионарный подкожный отек

Ангионевротический отек вследствие кожной сыпи лекарственного средства

Кольцевидное расположение поражений

Кольцевидные поражения у собаки с мультиформной эритемой

Истончение кожи или других тканей

Атрофия кожи, вызванная глюкокортикоидами

Заполненное жидкостью возвышение эпидермиса >1 см

Буллы у собаки с буллезным пемфигоидом

Наполненное кровью возвышение эпидермиса более 1 см

Межпальцевая геморрагическая булла у собаки с глубокой пиодермией и фурункулезом

расширенный волосяной фолликул, наполненный кератином, кожным салом

Комедоны на брюшной полости у собаки с гиперкортицизмом

Засохший экссудат и ороговевшие остатки на поверхности кожи

Многоочаговые корки, вызванные листовидной пузырчаткой

Узел, выстланный эпителием и содержащий жидкость или твердый материал.

Киста эпидермального включения

Обширная потеря пигмента

Депигментация носового платка у собак с витилиго.

Заплаты из-за кровоизлияния >1 см

Экхимозы лап у собак вследствие васкулита

Круглые чешуйки или корочки с эритемой, ассоциированные с фолликулитом или разорвавшимися пустулами или везикулами

Эпидермальные воротнички у собаки со стафилококковым поверхностным бактериальным фолликулитом

Дефект эпидермиса, не проникающий через базальную мембрану. Для дифференциации от язвы может потребоваться гистопатология.

Эрозии у собаки с васкулитом

Покраснение кожи из-за воспаления, закупорка капилляров

Эритема у собаки с кожной лекарственной сыпью

Толстая корка, часто связанная с некрозом, травмой или термическим/химическим ожогом

Эшар от физической травмы

Эрозии и/или изъязвления вследствие самотравмирования

Ссадины у кошки с атопическим дерматитом

Избыточный роговой слой, подтвержденный гистопатологией. Этот термин часто используется для описания носового зеркала и подушечек лап.

Трещины подушечек лап у собаки с поверхностным некролитическим дерматитом

Язва на поверхности кожи, которая начинается и граничит с ходами, распространяющимися в более глубокие, обычно подкожные ткани

Перианальные свищи у собак

Скопление чешуи на стержне волоса

Фолликулярные слепки вокруг шерсти собаки с гипотиреозом

Избыточный роговой слой, подтвержденный гистопатологией.Этот термин часто используется для описания носового зеркала и подушечек лап.

Идиопатический гиперкератоз зеркала носа (слева) и подушечек стоп (справа)

Повышенное содержание меланина в коже, часто вторичное по отношению к воспалению

Воспалительные поражения (слева), приводящие к поствоспалительной гиперпигментации (справа)

Частичная потеря пигмента

Идиопатическая гипопигментация носового платка

Отсутствие волос вследствие генетических факторов или дефектов эмбриогенеза.

Врожденный гипотрихоз у щенков шоколадного лабрадора.

Отсутствие кожного пигмента

Макулярная лейкодерма у собак

Потеря пигмента волос

Прогрессирующая лейкотрихия у больного витилиго.

Утолщение эпидермиса, часто из-за хронического воспаления, приводящее к чрезмерной текстуре

Лихенификация кожи у собаки с хроническим атопическим дерматитом и малассезиозным дерматитом

Плоское поражение, связанное с изменением цвета

Пигментное пятно (слева) Эритематозное пятно (справа)

Повышенное содержание меланина в коже может быть вторичным по отношению к воспалению.

Поствоспалительная гиперпигментация бедра этой собаки

Многоочаговый, папулезный, корковый дерматит; описательный термин, а не диагноз

Милиарный дерматит у кошки с аллергией на блох

Эритематозная, пятнистая, папулезная сыпь; эритематозные пятна обычно имеют диаметр 2-10 мм и сливаются, образуя более крупные поражения в некоторых областях

Кореподобные высыпания у собак с кожной реакцией на лекарства

Твердое возвышение >1 см

Узелки на носу у собаки с кожным гистиоцитозом.

Аномальная морфология ногтей вследствие инфекции, воспаления или травмы ногтевого ложа; могут включать: Онихогрифоз, Онихомадез, Онихорексис, Онихошизия

Ониходистрофия у собак с хронической аллергией

Аномальное искривление когтей; вторичный по отношению к воспалению или травме ногтевого ложа

Онихогрифоз у собаки с симметричной волчаночной ониходистрофией

Отслоение когтей вследствие воспаления или травмы ногтевого ложа

Онихомадез у собаки с симметричной волчаночной ониходистрофией

Фрагментация когтя вследствие воспаления или травмы ногтевого ложа

Онихорексис у собаки с симметричной волчаночной ониходистрофией

Расщепление когтей вследствие воспаления или травмы ногтевого ложа

Онихошизия у собаки с симметричной волчаночной ониходистрофией

Твердое образование на коже ≤1 см

Папулы у собаки с поверхностным бактериальным фолликулитом

Твердое образование на коже ≤1 см

Папулы у собаки с поверхностным бактериальным фолликулитом

Воспаление ногтевого валика

Паронихия у собаки с симметричной волчаночной ониходистрофией

Плоское поражение, связанное с изменением цвета >1 см

Гипопигментированное пятно (слева), эритематозное пятно (справа)

Небольшие эритематозные или фиолетовые поражения из-за кожного кровотечения

Петехии у собаки с кожным васкулитом

Расширение вен; чаще всего ассоциируется с гиперкортицизмом

Флебэктазия и кожная атрофия вследствие гиперкортицизма у собаки

Плосковершинное возвышение >1 см, образованное сливающимися папулами или кожной инфильтрацией

Бляшки у кошки с кожной лимфомой

Выступающая эпидермальная инфильтрация гноя

Пустулы на животе у собаки с поверхностной стафилококковой пиодермией.

Сетчатое расположение очагов поражения

Сетчатая лейкотрихия на спине лошади

Скопление рыхлых фрагментов рогового слоя

Рыхлая крупная чешуя из-за ихтиоза у золотистого ретривера

Фиброзная ткань, замещающая поврежденные кожные и/или подкожные ткани

Рубцы (справа) после заживления язвы (слева) у собаки со стерильным нодулярным дерматитом

Волнообразное, змеевидное расположение поражений

Серпигинозная крапивница у лошади

Необратимое расширение сосудов, приводящее к поражению красного или фиолетового цвета (редко)

Телеангиэктазии у собаки с ангиоматозом

Дефект эпидермиса, проникающий в базальную мембрану. Для дифференциации от эрозии может потребоваться гистопатология.

Изъязвления кожи у собаки с васкулитом.

Волдыри (крутостенные ограниченные возвышения на коже из-за отека) из-за реакции гиперчувствительности

Крапивница у лошади

Заполненное жидкостью возвышение эпидермиса,

Везикулы и буллы на ушной раковине, вызванные буллезным пемфигоидом

Крутостенное ограниченное возвышение кожи из-за отека

Волдыри, связанные с внутрикожным тестом на аллергию у лошади

Мультиазолрезистентный штамм Malassezia pachydermatis, выделенный от собачьего дерматита Malassezia | Медицинская микология

Аннотация

В представленном здесь случае мы описываем выделение устойчивого к азолу штамма M. pachydermatis от собачьего Malassezia дерматита. Изолят (NUBS18001) из этого случая показал минимальную ингибирующую концентрацию (МИК) в отношении итраконазола (ITZ) 320 мкг/мл по данным анализа микроразведений (BM) в бульоне, >32 мкг/мл по отношению к ITZ по E-тесту и >32 мкг /мл в КТЗ по Е-тесту. Синергетические эффекты между FK506 и ITZ в азол-резистентном штамме оценивали с использованием метода шахматной доски микроразведений. Устойчивый к ITZ штамм демонстрировал МИК 320 мкг/мл только ITZ и 5 мкг/мл только FK506; добавление FK506 ослабило ITZ MIC до 2.5 мкг/мл, что дает значение ITZ FICI 0,507. Этот результат свидетельствует о том, что комбинация ITZ и FK506 оказывает аддитивное действие на штамм, устойчивый к ITZ. Чтобы понять другой механизм, предположительно присутствующий в нашем мультиазол-резистентном штамме, мы секвенировали ген ERG11 из этого изолята и обнаружили миссенс-мутации (A412G и C905T) в последовательности открытой рамки считывания ERG11 ( ОРФ). Насколько нам известно, эта работа является первым сообщением о том, что устойчивый к множеству азолов штамм M.pacydermatis содержит мутации ERG11 .

Введение

Виды Malassezia , которые могут быть липофильными или липидозависимыми, принадлежат к резидентной кожной флоре животных, а также связаны с кожными заболеваниями собак и кошек. 1,2 Собачий Malassezia дерматит обычно лечат пероральными азолами, такими как кетоконазол (KTZ) и итраконазол (ITZ), когда местная терапия нецелесообразна или неэффективна. 1,2

Однако во всем мире сообщалось о резистентности KTZ и ITZ к изолятам из кожи собак. 3–8 Резистентность грибов к азолам может быть вызвана изменениями в биосинтезе стеролов (например, мутациями в ферменте-мишени лекарственного средства, стерол-14α-деметилазы, снижение сродства фермента к лекарственному средству), повышенной экспрессией гена-мишени ( ERG11 ), кодирующий этот фермент, или за счет повышенного оттока (например, за счет сверхэкспрессии генов, кодирующих мембранные белки ABC-транспортера (CDR1/CDR2) или главного фасилитатора ( MDR1 ) надсемейств). 9–13 Таким образом, предполагается, что сниженная чувствительность к азолам M. pachydermatis может быть результатом мутации ERG11 или увеличения экспрессии ERG11 или эффлюксных насосов. 14

В представленном здесь случае мы описываем выделение устойчивого к азолу штамма M. pachydermatis из собачьего дерматита Malassezia . Насколько нам известно, этот отчет представляет собой первое описание мутации ERG11 у этого вида.

Методы

Чемодан

Кастрированная миниатюрная такса (15 лет) была доставлена ​​в больницу для животных Sennan в Осаке, Япония, в августе 2016 г. Пациентка страдала дерматитом, вызванным Malassezia , с эритемой, восковыми корками и алопецией на передних лапах, животе, и паховой области. Несмотря на 23 дня лечения пероральным приемом 8 мг/кг ITZ один раз в день и еженедельным мытьем головы шампунем Malaseb TM (2% миконазол, 2% хлоргексидин; Dermcare Vet Pty. Ltd., Квинсленд, Австралия), поражения все еще наблюдались.

Микологическое исследование

Культивирование (32°С, 10 дней) кожных мазков с очагов поражения на модифицированной среде Диксона (3,6 % солодового экстракта, 0,6 % пептона, 2,0 % высушенной бычьей желчи, 1,0 % Tween 40, 0,2 % глицерина, 0,2 % олеиновой кислоты, 1,2% агар, рН 6,0) давали желтовато-кремовые колонии с прямыми краями.

Микроскопическое исследование показало, что дрожжевые клетки изолята имели эллипсоидальную форму (4–5 мкм × 2–2,0 мкм).5 мкм) с монополярным почкованием на широком основании. На основании этих морфологических данных изолят был идентифицирован как Malassezia spp. 15

Анализ гомологии последовательности внутреннего транскрибируемого спейсера (ITS) (ITS1-5.8S-ITS2) из ​​изолята проводили, как описано в предыдущих отчетах. 15,16

Тесты на чувствительность к противогрибковым препаратам

Чувствительность к противогрибковым препаратам оценивали в изоляте (NUBS18001) из этого случая, в трех изолятах собак (NUBS 18002, NUBS A-4 и NUBS A-2) из ​​трех других случаев и в штамме M. pachydermatis типа штамма CBS1879 T (таблица 1).

Таблица 1. Штаммы

, МИК (мкг/мл) противогрибковых препаратов и сайты мутаций генов ERG11 .

. . МИК (мкг/мл) . Нуклеотид . Аминокислота .
Штамм . Происхождение . ИТЗ + . ИТЗ . КТЖ† . замена # . замена # . 90 576
CBS1879 Т штамма 0,0625 0,064 0,125 Отсутствует Отсутствует
Nubs 18001 * собачьей Malassezia дерматит 320> 32> 32> 32 412A → G, 905C → T MET138VAL, VAL 302 ALA
Nubs 18002 Canine Malassezia Dermatitis

2

0. 0625 0,032 0,016 Отсутствует Отсутствует
Nubs А-4 собачьей Malassezia дерматит 4 8 8 381T → G None
Nubs A-2 Canine Malassezia Dermatitis

2 Dermatitis

0.5 0.58 4 NOTE NOTE
0.5
. . МИК (мкг/мл) . Нуклеотид . Аминокислота .
Штамм . Происхождение . ИТЗ + . ИТЗ . КТЖ† . замена # . замена # .90 576
CBS1879 Т штамма 0,0625 0,064 0,125 Отсутствует Отсутствует
Nubs 18001 * собачьей Malassezia дерматит 320> 32> 32> 32 412A → G, 905C → T MET138VAL, VAL 302 ALA
Nubs 18002 Canine Malassezia Dermatitis

2

0. 0625 0,032 0,016 Отсутствует Отсутствует
Nubs А-4 собачьей Malassezia дерматит 4 8 8 381T → G None
Nubs A-2

2

Canine Malassezia Dermatitis 0.58 0.38 4 None None
Таблица 1.

штаммов, MICS (мкг / мл) противогрибковых препаратов и сайтов мутации ERG11 генов.

. . МИК (мкг/мл) . Нуклеотид . Аминокислота .
Штамм . Происхождение . ИТЗ + . ИТЗ . КТЖ† . замена # . замена # . 90 576
CBS1879 Т штамма 0,0625 0,064 0,125 Отсутствует Отсутствует
Nubs 18001 * собачьей Malassezia дерматит 320> 32> 32> 32 412A → G, 905C → T MET138VAL, VAL 302 ALA
Nubs 18002 Canine Malassezia Dermatitis

2

0.0625 0,032 0,016 Отсутствует Отсутствует
Nubs А-4 собачьей Malassezia дерматит 4 8 8 381T → G None
Nubs A-2 Canine Malassezia Dermatitis

2 Dermatitis

0.5 0.58 4 NOTE NOTE
. . МИК (мкг/мл) . Нуклеотид . Аминокислота .
Штамм . Происхождение . ИТЗ + . ИТЗ . КТЖ† . замена # . замена # .90 576
CBS1879 Т штамма 0,0625 0,064 0,125 Отсутствует Отсутствует
Nubs 18001 * собачьей Malassezia дерматит 320> 32> 32> 32 412A → G, 905C → T MET138VAL, VAL 302 ALA
Nubs 18002 Canine Malassezia Dermatitis

2

0.0625 0,032 0,016 Отсутствует Отсутствует
Nubs А-4 собачьей Malassezia дерматит 4 8 8 381T → G None
Nubs A-2 Canine

2

Canine Malassezia Dermatitis

2

0. 5 0.38 0.38 4 None None

Антифунгированная восприимчивость к ITZ и KTZ была оценена с помощью метода микродистории Brooth (BM) и E- тестовое задание. 3–8

Исходную суспензию инокулята для использования в анализе BM и Е-тесте готовили из 7-дневной культуры, выращенной при 32°C на декстрозном агаре Сабуро (SDA; 1% пептона, 2% декстрозы). и 2% агара) с добавлением 1% твина 80; аликвоты суспензии перед тестированием доводили спектрофотометрически до оптической плотности 1,0 в стерильном 0,9% физиологическом растворе.

M. pachydermatis , липофильные и аэробные дрожжи, не демонстрируют достаточного роста в стандартной не содержащей липидов среде Roswell Park Memorial Institute (RPMI) 1640 (среда, которая используется в анализе BM CLSI M27-A2), исключая использование этой методологии для оценки восприимчивости у этого вида.Протокол CLSI M27-A2 был адаптирован путем изменения среды (вместо использования декстрозного бульона Сабуро (SDB) с добавлением 1% Tween 80) и времени инкубации (вместо инкубации в течение 72 часов при 32°C), как описано ранее. 4–8 Минимальная ингибирующая концентрация (МИК) ITZ определялась как самая низкая концентрация, демонстрирующая 100% ингибирование роста.

Штаммы Candida parapsilosis ATCC 22019 и Candida kruzei ATCC 6258 использовали в качестве контроля качества для метода микроразведений по протоколу CLSI M27-A2 с использованием не содержащей липидов среды RPMI 1640. 17

Е-тест проводили в соответствии с Техническим руководством 10 Е-теста (AB Biodisk, Solna, Швеция) с использованием 20 мл SDA с добавлением 1% Tween 80 в чашках Петри диаметром 90 мм. Е-тестовые градиентные полоски для этих препаратов были получены от AB BIODISK (АБ Биодиск). МИК ITZ и KTZ определяли после 72-часовой инкубации при 32°C.

Лекарственное взаимодействие в тестах на чувствительность

Лекарственное взаимодействие в тестах на чувствительность исследовали в соответствии с протоколом CLSI M27-A2 методом микроразведений 17 и оценивали с использованием метода микроразведений в шахматном порядке. 18 Взаимодействие между ITZ и FK506 (Sigma-Aldrich, Сент-Луис, Миссури, США) оценивали на ITZ-резистентном штамме (NUBS18001) после 4 дней инкубации при 32°C в SDB с добавлением 1% Tween 80 , Концентрации ITZ варьировались от 0,3125 до 320 мкг/мл, а концентрации FK506 — от 0,3125 до 320 мкг/мл. Опыт проводили в двух повторностях.

Фракционная ингибирующая концентрация (FIC) рассчитывалась для каждого агента путем деления MIC каждого препарата в комбинации на MIC отдельного препарата.Затем значения FIC суммировали для определения индекса фракционной ингибирующей концентрации (FICI), полученного в результате комбинаций лекарственных средств, с использованием следующего уравнения: FICI = FIC A + FIC B = C A Comb /MIC A Только + C BComb /MIC B Только , где MIC A Только и MIC B Отдельно) C A Comb и C B Comb представляют собой концентрации препаратов A и B (соответственно) при комбинировании. 17 Значения FICI были классифицированы следующим образом: синергизм, FICI ≤0,5; аддитивный эффект, 0,5 < FICI ≤1; индифферентный, 1 < FICI ≤4; и антагонизм, FICI >4. 19

Последовательность

ERG11

Для секвенирования комплементарной ДНК (кДНК) ERG11 из изолятов были приготовлены праймеры на основе консервативной последовательности матричной РНК (мРНК) M. pachydermatis ERG11 , которая кодирует цитохром p450 (инвентарный номер GenBank, XM_018138466).Праймеры перечислены в таблице 2.

Таблица 2. Праймеры

, использованные для амплификации и секвенирования гена M. pachydermatis ERG11 .

Праймер Sense . Последовательность смыслового праймера . Должность* . Обратный грунт . Обратная последовательность праймера . Должность* . +
MALAERG1S ATGTCAGACTTGATTTCTAT 1-20 MALAERG1R AAATGTCCACCGTCACAGAC 546-565
MALAERG2S TCAAGTCAGGTCTCTCGACG 431-450 MALAERG2R CAGCTACCAGTAGCACTGGA 931-950
MALAERG3S GGTACGGACCACGATATGAT 811-830 MALAERG3R GTTACCGCCAGTGCTGACC 1386-1404
MALAERG4S AGGCGAAGGGTCTTGAGCTG 1331-1350 MALAERG4R TTACTTGGCCAGCGCGGGGC 1604-1623
Праймер Sense . Последовательность смыслового праймера . Должность* . Обратный грунт . Обратная последовательность праймера . Должность* . +
MALAERG1S ATGTCAGACTTGATTTCTAT 1-20 MALAERG1R AAATGTCCACCGTCACAGAC 546-565
MALAERG2S TCAAGTCAGGTCTCTCGACG 431-450 MALAERG2R CAGCTACCAGTAGCACTGGA 931-950
MALAERG3S GGTACGGACCACGATATGAT 811-830 MALAERG3R GTTACCGCCAGTGCTGACC 1386-1404
MALAERG4S AGGCGAAGGGTCTTGAGCTG 1331-1350 MALAERG4R TTACTTGGCCAGCGCGGGGC 1604-1623
Таблица 2.

Праймеры, используемые для амплификации и секвенирования гена M. pachydermatis ERG11 .

Праймер Sense . Последовательность смыслового праймера . Должность* . Обратный грунт . Обратная последовательность праймера . Должность* . +
MALAERG1S ATGTCAGACTTGATTTCTAT 1-20 MALAERG1R AAATGTCCACCGTCACAGAC 546-565
MALAERG2S TCAAGTCAGGTCTCTCGACG 431-450 MALAERG2R CAGCTACCAGTAGCACTGGA 931-950
MALAERG3S GGTACGGACCACGATATGAT 811-830 MALAERG3R GTTACCGCCAGTGCTGACC 1386-1404
MALAERG4S AGGCGAAGGGTCTTGAGCTG 1331-1350 MALAERG4R TTACTTGGCCAGCGCGGGGC 1604-1623
90 576
Праймер Sense . Последовательность смыслового праймера . Должность* . Обратный грунт . Обратная последовательность праймера . Должность* .
MALAERG1S ATGTCAGACTTGATTTCTAT 1-20 MALAERG1R AAATGTCCACCGTCACAGAC 546-565
MALAERG2S TCAAGTCAGGTCTCTCGACG 431-450 MALAERG2R CAGCTACCAGTAGCACTGGA 931-950
MALAERG3S GGTACGGACCACGATATGAT 811-830 MALAERG3R GTTACCGCCAGTGCTGACC 1386-1404
MALAERG4S AGGCGAAGGGTCTTGAGCTG 1331-1350 MALAERG4R TTACTTGGCCAGCGCGGGGC 1604-1623

Четыре клинических изолята (таблица 1) были получены путем культивирования клеток на SDA с добавлением 1% Tween 80 при 32°C в течение 7 дней.Полученные дрожжевые клетки гомогенизировали в жидком азоте. Тотальную РНК экстрагировали из примерно 50 мг образцов с использованием набора RNeasy total RNA (QIAGEN, Токио, Япония). Устранение загрязнения геномной ДНК и обратную транскрипцию поли(А)+ РНК проводили с использованием набора для обратной транскрипции QuantiTect (QIAGEN).

Образцы кДНК (по 50 нг каждый) амплифицировали с помощью полимеразной цепной реакции (ПЦР) в объеме 30 мкл в реакционной смеси, содержащей 10 мМ трис-HCl (pH 8.3), 50 мМ KCl, 1,5 мМ MgCl 2 , 0,001% желатина, 200 мМ каждого дезоксинуклеозидтрифосфата, 1,0 единицы полимеразы Taq (Takara, Киото, Япония) и 30 мкмоль каждой пары праймеров. ПЦР-амплификацию (GeneAmp® PCR System 9700; Thermo Fisher Scientific KK, Токио, Япония) проводили в течение 30 циклов, состоящих из денатурации в течение 1 мин при 94°C, отжига праймеров в течение 2 мин при 60°C и удлинения в течение 2 мин. при 72°С. Окончательное удлинение проводили при 72°C в течение 5 мин. Продукты ПЦР выявляли электрофорезом на 2% агарозном геле с последующим окрашиванием бромистым этидием и визуализацией в УФ-свете.Продукты ПЦР клонировали в вектор pCRII (Invitrogen, Сан-Диего, Калифорния, США). Плазмидную ДНК из более чем трех клонов каждого вида экстрагировали с использованием набора плазмид QIAGEN (QIAGEN, Валенсия, Калифорния, США) и раздельно секвенировали методом дидезокси-терминации цепи с использованием анализатора ДНК ABI PRISM 3130 (Thermo Fisher Scientific, Inc. , Токио, Япония).

Результаты

Молекулярная идентификация изолята

Базовый анализ инструмента локального поиска выравнивания (BLAST) в Национальном центре биотехнологической информации (NCBI; https://blast.База данных ncbi.nlm.nih.gov/Blast.cgi) использовалась для изучения отношений гомологии ITS-области из изолята. Нуклеотидная последовательность ITS-области изолята (NUBS18001) была на 100% идентична последовательности (инвентарные номера GenBank KY104164 и KY104162) из ​​эталонных штаммов (CBS6534 и CBS1882 соответственно) из коллекции культур M. pachydermatis . На основании этих результатов наш изолят был определен как штамм M. pachydermatis NUBS18001.

МПК изолятов

МИК определяли после 72-часовой инкубации при 32°С.Изолят (NUBS18001) из этого случая показал МИК 320 мкг/мл для ITZ по BM, >32 мкг/мл для ITZ по E-тесту и >32 мкг/мл для KTZ по E-тесту (рис.  1 и Таблица 1), что означает, что изолят был устойчивым в соответствии со стандартными контрольными точками. 4–8 Другие изоляты и CBS1879 T были чувствительны к ITZ и KTZ с МИК 0,0625 мкг/мл для ITZ по данным BM и 0,032–8 мкг/мл для ITZ по E-тесту.

Рисунок 1.

Е-тест на ITZ против восприимчивого к ITZ штамма (CBS 1879 T ; панель A) и для сравнения штамма, устойчивого к ITZ (NUBS 18001; панель B).ИТЗ, итраконазол.

Рисунок 1.

E-тест на ITZ против восприимчивого к ITZ штамма (CBS 1879 T ; панель A) и для сравнения штамма, устойчивого к ITZ (NUBS 18001; панель B). ИТЗ, итраконазол.

Взаимодействие FK506 и ITZ для устойчивого к ITZ изолята

Противогрибковая активность ITZ и FK506, по отдельности и в комбинации, была протестирована на устойчивых к ITZ штаммах, культивируемых в SDB с добавлением 1% Tween 80 после 4 дней инкубации при 32°C. Определяли МИК для 90% ингибирования (МИК90) для каждого лекарственного средства отдельно или в комбинации. Устойчивый к ITZ штамм демонстрировал МИК 320 мкг/мл только ITZ и 5 мкг/мл только FK506; добавление FK506 ослабило ITZ MIC до 2,5 мкг/мл, что дало значение ITZ FICI 0,507 (расчет; 2,5/320 + 2,5/5 = 0,507). Этот результат свидетельствует о том, что комбинация ITZ и FK506 оказывает аддитивное действие на штамм, устойчивый к ITZ.

ERG11 последовательность устойчивого к ITZ изолята Анализ

BLAST с использованием базы данных NCBI показал, что кДНК ERG11 устойчивого к азолу штамма кодирует Met в кодоне 138 и Val в кодоне 302 по сравнению с Val и Ala (соответственно) в цитохроме p450, кодируемом M.pachydermatis ERG11 мРНК (инвентарный номер GenBank, XM_018138466) (таблица 1).

Последовательности, определенные в этом исследовании, были депонированы в GenBank ( Malassezia pachydermatis NUBS18001 ERG11 мРНК ланостерол-14-альфа-деметилазы, полная кодирующая последовательность; инвентарный номер GenBank LC369026).

Обсуждение

В этом исследовании мы сообщаем об выделении штамма M. pachydermatis , происходящего от собачьего дерматита Malassezia , который обладает устойчивостью in vitro к ITZ и KTZ.Мы предполагаем, что охарактеризованный здесь устойчивый к азолу штамм был также выделен от больной собаки, которая получала азоловую терапию и демонстрировала сверхэкспрессию генов, кодирующих членов семейства транспортеров ABC, или мутации в ERG11.

В сочетании с азольными противогрибковыми средствами ингибитор кальциневрина FK506 синергетически усиливает фунгицидную активность. Ранее было показано, что 18 FK506 устраняет множественную лекарственную устойчивость в различных типах эукариотических клеток, эффект, опосредованный блокадой АТФ-зависимых насосов оттока, включая P-гликопротеин человека, в C.голая . 18 Синергетические эффекты FK506 в сочетании с азолами были обнаружены во всех испытанных штаммах Candida , устойчивых к азолам, что доказывает, что насосы оттока способствуют устойчивости к противогрибковым препаратам у этого рода. 18 Противогрибковая активность ITZ и FK506 по отдельности и в комбинации была протестирована на азол-резистентном штамме (NUBS 18001). Эти результаты показали, что комбинация ITZ и FK506 оказывает аддитивное действие на наш устойчивый к ITZ изолят.Поэтому мы предположили, что АТФ-зависимые насосы оттока не были единственными медиаторами устойчивости к противогрибковым препаратам у этого штамма, что предполагает наличие одной или нескольких дополнительных мутаций устойчивости к противогрибковым препаратам.

Чтобы понять другой механизм, предположительно присутствующий в нашем мультиазол-резистентном штамме, мы секвенировали ген ERG11 из этого изолята и обнаружили миссенс-мутации (A412G и C905T) в последовательности открытого чтения ERG11 . кадр (ОРФ). Насколько нам известно, эта работа является первым сообщением о том, что устойчивый к множеству азолов штамм M.pachydermatis содержит мутации ERG11 .

Необходимы дальнейшие исследования для определения механизма устойчивости к азолам этого и других изолятов M. pachydermatis . Чтобы исследовать взаимосвязь между этими аминокислотными заменами и толерантностью к азолам, точечные мутации, приводящие к нескольким аминокислотным заменам, обнаруженным в белке ERG11 резистентного изолята, будут введены в эндогенный ген ERG11 штамма M.pachydermatis с помощью инструментов для генетических манипуляций.

Чувствительность клинических изолятов к противогрибковым препаратам может быть основным фактором, определяющим исход лечения.

Благодарности

Это исследование было поддержано грантом («Международные совместные исследования и обучение молодых исследователей по борьбе с зоонозами в глобализованном мире») Министерства образования, культуры, спорта, науки и технологий (MEXT) Японии.

Декларация интересов

Авторы сообщают об отсутствии конфликта интересов.Только авторы несут ответственность за содержание и написание этой статьи.

Ссылки

1.

Миллер

WH

,

Гриффин

CE

,

Кэмпбелл

KL

.

Malassezia дерматит. В: Дерматология мелких животных Мюллера и Кирка . 7-е изд. Сент-Луис, Миссури

, США: Elsevier Mosby,

2013

:

243

249

.2.

Облигация

Р

.

Malassezia дерматит

, В:

Зеленый

CE

, изд.

Инфекционные болезни собак и кошек

. 4-е издание,

Сент-Луис, Миссури, США

:

Saunders Elsevier

,

2012

:

602

606

.3.

Ниджима

М

,

Кано

Р

,

Нагата

М

и др.

Устойчивый к азолам изолят Malassezia pachydermatis

.

Вет Микробиол

.

2011

;

149

:

288

290

.4.

Кафарчия

C

,

Фигередо

LA

,

Иатта

R

и др.

In vitro оценка чувствительности Malassezia pachydermatis к азольным соединениям с использованием Е-теста и методов микроразведений CLSI

.

Мед Микол

.

2012

;

50

:

795

801

.5.

Кафарчия

C

,

Фигередо

LA

,

Ятта

R

и др.

Противогрибковая чувствительность in vitro Malassezia pachydermatis у собак с кожными поражениями и без них

.

Вет Микробиол

.

2012

;

155

:

395

398

.6.

Cafarchia

C

,

Figueredo

LA

,

Favuzzi

V

и др.

Оценка противогрибковой чувствительности Malassezia pachydermatis в различных средах с использованием протокола CLSI

.

Вет Микробиол

.

2012

;

159

:

536

540

.7.

Альварес-Перес

S

,

Гарсия

ME

,

Пелаес

T

и др.

In vitro Противогрибковая активность местных и системных противогрибковых препаратов в отношении видов Malassezia

.

Мед Микол

.

2016

;

54

:

72

79

.8.

Ватанабе

S

,

Койке

A

,

Кано

R

и др. .

J Vet Med Sci

.

2014

;

76

:

579

581

.9.

Моршхойзер

J

.

Генетическая основа развития резистентности к флуконазолу у Candida albicans

.

Биохим Биофиз Акта

.

2002

;

1587

:

240

248

.10.

Gullo

FP

,

Rossi

SA

,

Sardi

JdeC

и др.

Криптококкоз: эпидемиология, грибковая резистентность и новые альтернативы лечению

.

Eur J Clin Microbiol Infect Dis

2013

;

3

:

1377

1391

.11.

Кано

R

,

Собукава

H

,

Мураяма

SY

и др.

In vitro r Устойчивость Aspergillus fumigatus к азоловому фунгициду

.

J Заразить Chemother

.

2016

;

22

:

133

136

.12.

Кано

R

,

Окубо

М

,

Хасэгава

А

и др.

Мультиазол-резистентные штаммы Cryptococcus neoformans var. grubii , выделенный из штамма, устойчивого к FLZ, путем культивирования в среде, содержащей вориконазол

.

Мед Микол

.

2017

;

55

:

877

882

.13.

Yamada

T

,

Maeda

M

,

Alshahni

MM

и др.

Устойчивость к тербинафину клинических изолятов Trichophyton , вызванная специфическими точечными мутациями в гене скваленэпоксидазы

.

Противомикробные агенты Chemother

2017

;

61

: :

e00115

17

.14.

Робсон

Д

.

Malassezia : механизмы возможной лекарственной устойчивости

.

2007

:

63

67

.15.

Guéo-Kellermann

E

,

Батра

R

,

Boekhout

T

.

Malassezia Baillon (1889)

In:

Kurtzman

CP

,

Fell

JW

,

Boekhout

T , 9000ed.

Дрожжи, таксономическое исследование

.

Том 3

, 5-е изд.

Амстердам

,

Elsevier

,

2011

:

1807

1836

.16.

Белый

TJ

,

Bruns

T

,

Lee

S

и др.

Амплификация и прямое секвенирование генов рибосомных РНК грибов для филогенетики

. В:

Иннис

МА

,

Гельфанд

ДХ

,

Снинский

ЖЖ

,

Белый

ТЖ

.ред. Протоколы ПЦР — руководство по методам и приложениям.

Сан-Диего, Калифорния, США

:

Academic Press

,

1990

:

315

322

.17.

НККЛС; Национальный комитет по клиническим и лабораторным стандартам

.

Эталонный метод тестирования дрожжей на чувствительность к противогрибковым разбавлениям в бульоне

. . Национальный комитет клинических лабораторных стандартов.

Филадельфия, Пенсильвания, США

:

Wayne

,

2002

.18.

Denardi

LB

,

Mario

DA

,

Loreto

ES

и др.

Синергическое действие такролимуса и азольных противогрибковых соединений на флуконазолчувствительные и флуконазолрезистентные изоляты Candida glabrata

.

Браз Дж Микробиол

.

2015

;

46

:

1255

129

.19.

Милн

КЕ

,

Гулд

ИМ

.

Комбинированное тестирование чувствительности к противомикробным препаратам штамма Stenotrophomonas maltophilia с множественной лекарственной устойчивостью у пациентов с муковисцидозом

.

Антимикробные агенты Chemother

.

2012

;

56

:

4071

4077

.

© Автор(ы), 2018 г.

Добавить комментарий

Ваш адрес email не будет опубликован.