+8 (916) 786-78-28 с 10.00 до 22.00 ежедневно

Меню

Срок беременности у собак: Беременность и роды у собак разных пород и размеров

Особенности рациона собак во время беременности

Успешное протекание беременности, как и будущее здоровье щенков во многом зависит от сбалансированности диеты животного после вязки. Обычно беременность у собак длится около девяти недель, в течение которых собаководам следует уделить особое внимание правильному рациону своих питомцев. 

При этом, срок беременности условно разделяется на три периода, которые характеризуются разной продолжительностью и постоянно изменяющимися потребностями животного в положении.

Первый этап

Во время первого периода беременности, который длится около 4-5 недель, количество потребляемых калорий менять не следует. При натуральном кормлении в привычный рацион рекомендуется ввести витаминно-минеральные добавки, которые содержат следующие компоненты:

  • кальций;
  • рыбий жир;
  • витамины А, Д, Е;
  • фосфор;
  • фолиевую кислоту;
  • жирные омега-кислоты;
  • серу;
  • пивные дрожжи.

Однако нововведения должны быть одобрены ветеринаром, ведь переизбыток витаминов так же вреден, как и их недостаток.

Второй этап

Начало этого периода приходится на пятую неделю беременности, когда у собаки резко возрастает аппетит. Для его удовлетворения необходимо повысить количество высококачественной белковой пищи. В рационе собаки должны появиться следующие продукты:

  • говяжьи почки и сердце;
  • баранина;
  • мускульное мясо;
  • яйца;
  • лосось;
  • скумбрия;
  • сельдь;
  • козье молоко;
  • йогурт.

В этот период специалисты не рекомендуют злоупотреблять кашами и мучными изделиями, а обратить внимание на фрукты и овощи. В целом объем потребляемых собакой калорий должен увеличиться почти на треть.

Третий этап

Заключительный период беременности наступает за две недели до родов, когда живот будущей мамы становится большим, а увеличенная матка давит на пищеварительные органы.  

Чтобы собака не испытывала дополнительный дискомфорт из-за пищеварения, необходимо разделить суточную норму питания на пять приемов пищи малыми порциями. Главное не перекармливать животное, ведь ожирение может серьёзно осложнить процесс родов. 

К тому же нельзя забывать про свежую воду. Учитывая, что она необходима для вырабатывания амниотической жидкости в околоплодных пузырях, питьевая вода должна быть рядом с собакой всегда.

Готовые корма для беременных собак

Специализированные линейки готовой продукции для беременных и кормящих собак способны удовлетворить все потребности животных. В их состав входят все необходимые витамины и добавки. Однако если собака изначально привыкла к натуральному питанию, специалисты категорически не рекомендуют во время беременности переходить на готовые корма или менять продукцию одной торговой марки на другую.

Ветврач рассказала о современных методах ведения беременности у кошек и собак

Признаки беременности на УЗИ будут видны уже на 10–11-й день после вязки. На рентгене – с 36-го дня у кошек и с 45-го – у собак, отметила она.

«Срок беременности можно установить по диаметру плодного пузыря, бипариетальному размеру (поперечное сечение головы) и по диаметру тела (поперечное сечение в области желудка). Для более точного определения срока необходимо измерять диаметры нескольких плодов сразу», – рассказала Татьяна Алейникова.

Во время беременности для ее нормального протекания ветврач рекомендует следить за сбалансированным питанием питомца. Переизбыток витаминов и микроэлементов также может негативно сказаться на здоровье. «Например, превышение кальция в рационе может привести к подавлению паращитовидной железы и спровоцировать послеродовую эклампсию, передозировка витамина А вызывает расщепление неба, деформацию ушей, хвоста и другие уродства у плода, а избыток витамина Д может привести к стенозу клапанов сердца», – отметила ветврач.

Накануне родов у животного появляются первые признаки скорого появления потомства. Зверь начинает «подготавливать нору» для своего потомства. Также за несколько дней до родов проявляются признаки лактации.

«Наиболее точными признаками приближающихся родов выступают падение ректальной температуры и уровня прогестерона за 12 часов до родов», – рассказала она.

Падение уровня прогестерона до 2 нг/мл является достаточно точным признаком приближающихся родов, который часто используют при проведении планового кесарева сечения. «Одновременно с уменьшением уровня прогестерона у плода начинает вырабатываться сурфактант в легких. Если сделать кесарево сечение раньше, возможны проблемы с дыхательной системой у потомства», – пояснила ветврач.

Показания же к кесареву сечению могут быть самыми разными. Например, слабость или полное отсутствие родовой деятельности, перенашивание беременности, увеличение количества эмбрионов, нехарактерное для данного вида или породы животного, риск разрыва матки, в особенности если ранее животному уже делали кесарево, перекрут матки, отслоение плаценты и ряд других.

Также к кесареву сечению могут прибегнуть ветврачи в том случае, если есть риск травмирования матери или ее гибели во время естественных родов.

Сколько длится беременность у собак крупных и мелких пород?

Сегодня практически каждый владелец домашней любимицы прекрасно понимает, что беременность у собак является самым важным моментом во всей ее жизни, во время которой хозяину придется оказывать питомцу всяческую помощь. Естественно, что сразу же после процесса вязки неизвестно, забеременело ли животное либо нет. Все равно необходимо обеспечить собачке не только более тщательный, но и особенный уход, что будет являться залогом получения нормально развитого и здорового потомства.

Владельцу нужно иметь больше информации о беременности собачек для явного представления протекания этого важного процесса. Ведь и роды тоже придется принимать ему. В данной статье будут освещены такие вопросы: сколько длится беременность у собак, основные признаки беременности, а также какой уход требуется в этот период домашней любимице.

Время зачатия

Чтобы иметь представление, сколько длится беременность у собак мелких пород, да и крупных видов, следует знать точное время зачатия. После того как яйцеклетка самки и сперматозоид кобеля слились, именно это время и является непосредственно зачатием. Оптимальный вариант, когда сперматозоид перемещается к яйцеклетке в продолжение 1 часа после завершения процесса вязки. Среднее время, необходимое для полноценного оплодотворения, составляет 6-7 суток.

В дальнейшем состояние питомицы напрямую зависит от жизнеспособности ее организма. Разные породы собак различаются временем начала овуляции – на 4-е, 6-е, 8-е сутки течки либо в гораздо более позднее время. По этой причине однократной вязки может оказаться недостаточно. Сучка готова к спариванию уже на 9-е сутки с момента начала течки. Подробнее про течку у собак можно почитать здесь.

Если спаривание будет осуществлено на 9-й либо 11-й день, то этого бывает достаточно для успешного оплодотворения.

Ниже будет подробнее описано, сколько месяцев длится беременность у собак до момента начала родов.

Продолжительность беременности

Чаще всего ответом на вопрос, сколько ходят беременные собаки, является цифра 56-66 суток после непосредственной вязки. Однако максимально жизнеспособными щенками считаются питомцы, рожденные в промежуток времени с 53 по 71 сутки. Вообще же, срок беременности находится в зависимости как от возраста сучки, так и порядкового номера настоящей беременности.

Срок хождения беременной собачки гораздо больше у представительниц крупных пород, а также у первородящих мамочек. Тогда как собаки, уже рождающие второй и последующий разы, а также особи мелких видов, отличаются гораздо меньшим сроком беременности. Если же щенки не появились на свет вовремя, следует пересмотреть дату вязки. Обычно принято вязать самку 3 раза за 1 неделю.

При этом беременность может наступить после абсолютно любой из вязок. Возможно, что оплодотворение случилось лишь на 3-й вязке.

В таком случае будет вполне естественным, что срок беременности у собак смещается на 1 неделю. Также бывают ситуации, когда сам владелец домашней любимицы допускает ошибку при расчетах срока беременности. Ведь природа мать практически никогда не преподносит сюрпризов.

Беременность по дням: симптомы и признаки

Так как определить период беременности у собак самостоятельно? Типичные признаки беременности тесно связаны со сроком этого явления. До наступления 3-й недели беременности практически никаких видимых изменений в поведении собачки не отмечается, разве что излишняя сонливость, а также апатия.

По этой причине описание характерных признаков беременности будет дано, начиная с 25 суток интересного положения будущей «мамочки». К 25-30 суткам в месте расположения молочных желез происходит набухание как кожного покрова, так и непосредственно самих желез, которые приобретают розовый оттенок у питомцев, имеющих светлую кожу. Несмотря на то, что беременность собаки длится 57-66 суток, в это время за ребрами животного можно наблюдать увеличение объема живота.

Уже на 21-24 сутки можно при помощи аппарата ультразвука диагностировать беременность домашней любимицы. На экране различаются околоплодные пузыри, в которых и находятся зародыши. Наиболее характерные признаки интересного положения начинают проявляться с наступлением 29 суток срока. Этот период характеризуется значительным увеличением молочных желез, тогда как за 7-9 суток до родов у мамочек с опытом появляется молочко.

Несмотря на небольшую продолжительность беременности у собак мелких пород и крупных, у первородящих собачек молочко может сформироваться как непосредственно во время родов, так и за пару часов до их наступления. Начиная с 33 суток, масса будущей «мамочки» резко растет. На 6-7 неделе в матке уже можно нащупать отдельные плоды, различаются кости черепа и ребра эмбрионов. При помощи рентгена выясняют точное количество щенков будущего помета.

Первая беременность собаки

Продолжая рассмотрение темы «сколько месяцев ходит беременная собака», следует отметить тот факт, что первая беременность представляет собой настоящее испытание для домашней любимицы. Продолжительность 1-й беременности несколько больше, чем последующих, а также она гораздо чаще протекает с различными осложнениями. Владельцу молодой собачки не нужно полагаться на «природу». Одомашненные животные не ровня собакам, проживающим в естественных природных условиях.

По этой причине первая беременность должна планироваться за 3-4 месяца до первой вязки. За данный период домашняя любимица должна хорошо развить свои мышцы, а лишний жирок согнать. Необходимо со всей тщательностью подойти к процессу подбора рациона питания, сделать все необходимые прививки, а также уничтожить гельминтов и блох.

Поскольку первая беременность у собаки подчас приводит к осложнениям, необходимо регулярно контролировать состояние здоровья питомицы.

После своих первых родов собачка может проявлять беспокойство: бегать по вольеру либо комнате, вскакивать, будто бы не знать, как поступать с потомством. Это нормальная реакция, и впадать в панику владельцу не стоит, ведь спустя 6-8 суток все пройдет. Просто нужно собачку укладывать к щенкам и наблюдать, чтобы любимица случайно не навредила малышам.

После того, как беременная собака разрешилась от бремени первый раз, она может проявлять беспокойство. Так как молочка у нее много, а совсем крошечные щенки еще не в состоянии полностью высосать его запасы. Как только они подрастут, собачка успокоится.

Причины, влияющие на продолжительность срока

Продолжая рассмотрение вопроса, сколько беременность у собак длится, необходимо указать факторы, влияющие на продолжительность этого явления. Самой распространенной причиной является нарушение правил спаривания питомцев. Очень много собачников считает, что однократной вязки для оплодотворения вполне достаточно, однако могут при этом ошибиться с датой овуляции. В итоге, при вязке на 12-е сутки, по причине сдвига времени овуляции, у животного беременность не наступает.

В такой ситуации как сучка, так и кобель должны быть обследованы на предмет наличия каких-либо отклонений в здоровье по следующим показателям:

  • Протекание предыдущей беременности.
  • Размер помета у кобеля и сучки.
  • Наличие болезней репродуктивных органов у животных.
  • Количество отказов от случки. Здесь может пригодиться дневник беременности собак либо случек.
  • Протекание периода течки.
  • Различные гормональные нарушения.
  • Ложная беременность.

Второй причиной, оказывающей влияние на то, сколько месяцев беременность у собак продолжается, является отсутствие возможности у питомцев нормально спариваться. Обычно это относится к еще пока молодым кобелям, которые по причине многочисленных телодвижений не способны в полной мере проникнуть в преддверие влагалища сучки. В итоге сперма попадает только в преддверие влагалища.

Некоторая часть сперматозоидов погибает в результате кислой среды, а оставшаяся часть не всегда может достигнуть яйцеклетки. В такой ситуации беременность может наступить очень поздно либо не наступить вовсе. Третий фактор, оказывающий влияние на то, сколько ходит беременная собака немецкая овчарка – это плохие показатели качества спермы кобеля. Здесь подразумевается недостаточная подвижность сперматозоидов, незначительный их объем и морфология.

Объем спермы напрямую связан с массой питомца, а также его размеров. При недостаточной подвижности сперматозоидов либо неудовлетворительной морфологии у сучки беременность может совсем не наступить, либо все зародыши просто погибнут. По этой причине после вязки каждый владелец должен иметь представление, какой срок беременности у собак, и как она протекает.

Ложная беременность

Если владелец домашней любимицы имеет представление, как развивается беременность у собак, то он наверняка знает, что ложная беременность является синдромом психических и физиологических расстройств, происходящих в организме собачки. Все это вызвано отклонениями в функционировании половых желез. Ложное положение своими внешними признаками напоминает обычную беременность – изменяется пигментация молочной железы, увеличивается живот, формируется молозиво. Тем не менее, беременности нет.

Единственным признаком, который способен указать неопытному собачнику, что беременность ложная, является фактор отсутствия шевеления зародышей в животике у будущей «мамы».

Кинологи также отмечают излишнюю возбудимость животного. Она как будто сходит постепенно с ума. Может наблюдаться токсикоз у собак при беременности, тогда как при ложном положении его нет.

Такая собачка с большой охотой готовит «гнездо» для будущего потомства, проявляет тщательную заботу о якобы существующих щенках, в роли которых могут выступать мягкие игрушки. Идти гулять не спешит, а при возвращении моментально стремиться проявить заботу своим воображаемым «щенкам».

Если наблюдается проявление таких признаков материнства, то необходимо обратиться к ветеринарному врачу. Хотя и сам владелец в состоянии прекратить вымышленную беременность. В этих целях сцеживать молоко запрещено, просто нужно исключить из рациона питания молочные продукты, постоянно отвлекать питомицу от исполнения «материнских обязанностей», а также давать различные успокоительные препараты. Все вышеперечисленное поможет ответить на вопрос, как определить беременность собаки в домашних условиях самостоятельно.

Такой вопрос, сколько носит собака – беременность в зависимости от породы, волнует основную массу собачников, которые занимаются содержанием домашних любимиц. Вне зависимости от того, какая это по счету беременность у животного, осуществлять контроль за состоянием его здоровья необходимо с самого момента вязки.

Во все время беременности следует оградить питомца от возникновения стрессовых ситуаций, от различных физических нагрузок, а также обеспечивать его исключительно качественными кормовыми рационами. А для сохранения иммунитета можно применять витамины для беременных собак в течение всего срока. Только так можно рассчитывать на получение здорового и крепкого потомства. Читайте статью: Каким должен быть корм для беременных собак?

Период беременности. Собака Кане-Корсо

Период беременности

После продуктивной вязки у сук наступает беременность, продолжающаяся примерно 9 нед. Однако роды могут наступить преждевременно или, наоборот, срок беременности удлиняется в среднем на 1 нед. Тем не менее в обоих случаях вероятность рождения нормальных, здоровых щенков достаточно высока, просто нужно заранее подготовиться к родам и уметь правильно оказать помощь щенящейся собаке.

До 4-й нед беременности развитие и рост плодов выражены довольно слабо, поэтому в это время собака еще не нуждается в особом режиме содержания и кормления. Однако восприимчивость собаки к инфекционным заболеваниям в данный период повышается. Кроме того, у нее отмечается негативная реакция на лекарственные средства и химические препараты. Поэтому следует отказаться от применения противопаразитарных и других лекарственных препаратов в течение всего периода беременности собаки.

После 4-й нед беременности собаку должен осмотреть ветеринар. В период между 4-й и 5-й нед он уже может определить количество вынашиваемых щенков, прощупывая уплотнения в животе суки. С 5-й по 6-ю нед беременности проводить прощупывание крайне нежелательно. В течение 8-й нед происходит формирование головок плодов и отмечается их шевеление.

С 4-й по 6-ю нед беременности нужно кормить собаку 3 раза в день, а общая дневная норма должна быть увеличена путем введения в рацион дополнительного количества мясной и рыбной пищи, творога, молока, каш, сваренных на молоке, и супов. Суточная доза минеральных веществ в это время возрастает почти в 2 раза. Во второй половине беременности собака должна получать в качестве подкормки пюре из сырых фруктов и овощей, а количество углеводистой пищи нужно снизить.

В период с 30-го по 60-й день беременности полезно давать суке костную муку (2 ст. ложки в день) и витамин А (5-6 капель ежедневно).

Начиная с 6-й нед беременности следует исключить слишком подвижные, активные игры из распорядка дня собаки: в этот период ей необходим щадящий режим. Однако длительность прогулок может оставаться прежней, за исключением тех случаев, если собака испытывает усталость от долгого пребывания на улице. В этом случае целесообразно заменить 2 продолжительные прогулки несколькими короткими.

С 8-й нед беременности собаку следует перевести на 4-разовый режим кормления. Не рекомендуется включать в рацион кости, а также те продукты, которые могут затруднять перистальтику кишечника. Дозировка минеральных веществ остается прежней. Вместо мяса желательно давать собаке отварную морскую рыбу (по калорийности 150-160 г рыбы равноценны 100 г мясной пищи). Исключение из рациона мяса воспрепятствует развитию токсикоза (эклампсии). В последние недели перед родами прогулки должны быть менее длительными, но частыми. Следует тотчас же отправляться домой всякий раз, когда будет замечено, что собака устала. Частые выгулы необходимы еще и потому, что на последних неделях беременности суке приходиться мочиться чаще, чем обычно. На 7-8-й нед собака не должна участвовать в активных играх, бегать, перепрыгивать через препятствия, купаться в реке.

Накануне родов у собаки увеличиваются соски, при легком сжатии из них начинает выделяться беловатая жидкость – молозиво.

На 9-й нед беременности суточный объем пищи, потребляемой собакой, нужно уменьшить приблизительно на 1/4. Корм следует давать малыми порциями, 5-6 раз в день.

Данный текст является ознакомительным фрагментом.

Продолжение на ЛитРес

признаки, диагностика, сколько длится и как протекает у питомцев

Для получения качественного и здорового потомства от своей любимой собаки, весь период беременности нужно тщательно ухаживать и следить за домашней любимицей. Ведь, как и у женщин – это самые трепетные дни в ожидании чуда.

Содержание

Открытьполное содержание

[ Скрыть]

Сколько длится беременность у разных пород собак?

Ответить на вопрос, сколько длится беременность у собак, однозначно нельзя. Все зависит от породы домашнего животного. Стоит рассмотреть на конкретных случаях. Если вы — обладатель крупной породы, то средняя длительность беременности у собак длится около 63 дней.

Известны случаи, когда появление щенков проходило на ранних (50-55 дней) и поздних (70-72 дня) сроках. Потомство было здоровое, крепкое и сильное. Есть одна причина, по которой может продолжительность беременности измениться. Заключается она в количестве щенков, которые находятся в утробе матери. Учеными доказан тот факт, что собаки крупных пород рожают меньше щенков в отличие от мелких питомцев.

Если вы — обладатель более мелких пород, то будьте готовы, что продолжительность беременности составит около двух месяцев(60-62 дня). Количество щенят в утробе матери может насчитываться несколькими единицами. Можно прибегнуть к услугам ультразвукового исследования. В более поздний период беременности ветеринар может нащупать их и посчитать поголовно.

Признаки «интересного» положения у питомицы

Когда немного есть представление о том, сколько длится «интересное» положение, стоит перейти к насущным вопросам и их решениям. Распознать признаки беременности у собак с легкостью может опытный ветеринар. Но ведь хозяевам своих питомцев тоже хочется определить, что любимица станет мамой.

Стоит сразу запомнить одно, что в первые дни или даже недели после вязки не стоит ожидать каких-то изменений. В большинстве случаев после успешного оплодотворения может наблюдаться течка. И это считается нормальным явлением. При желании можно сделать тест и определить есть ли долгожданная беременность или нет.

Первичные признаки

Примерно после 20 дня вязки могут появиться следующие предвестники беременности:

  • небольшая апатия;
  • больше времени питомца уходит на сон;
  • собака перестает играть и веселиться;
  • становится флегматичной.

Понять, что наступила беременность у собак можно и по другим явным причинам, например, по положительному тесту. Или:

  1. Токсикоз. В среднем длится около 7-10 дней. Как правило, такое состояние не считается опасным для здоровья суки и будущего приплода. Токсикоз приходится на утренние часы. Чтобы как-то помочь пушистому домочадцу справиться с проблемой, можно давать мягкую пищу небольшими порциями.
  2. Изменение во внешнем виде. Определить беременность у собак можно и этим методом. Происходит это, как правило, на конец первого месяца. Наблюдается набухание молочных желез и изменение цвета.

Вторичные признаки

Тут уже ничего не скроется от взора хозяина. Определить беременность можно по следующим признакам:

  • потемнение молочных желез;
  • увеличение их в размере;
  • живот у собаки становится заметным и большим;
  • возрастание аппетита даже у «малоешек»;
  • изменение размера талии, если, конечно, вы замеряли ее сразу после вязки;
  • изменение характера питомицы, в некоторых случаях собаки становятся агрессивными;
  • рукой можно нащупать плоды (примерно 40-45 день).

Собачья беременность по неделям

Пройдено много от поисков идеального отца до появления первых признаков беременности и положительного теста. Чтобы было хоть какое-то представление о том, как проходит процесс формирования щенков, предлагаем изучить календарь беременности собак по дням с фото развивающегося эмбриона.

СрокОписание
1 неделя

(0-7 день)

На этот период приходятся основные действия:
  • овуляция;
  • спаривание;
  • оплодотворение.

Сука забеременела. Для питомицы нежелательны изменения в рационе и в физических нагрузках. Стоит начинать подмешивать в еду специальные добавки и витамины. Можно попробовать сделать тест. Беременность протекает незаметно.

2 неделя

(7-14 день)

Яйцеклетки превращаются в щенков. К концу второй недели все эмбрионы опускаются в матку. Физические нагрузки и кормление остается на прежнем уровне. Если в первую неделю тест не дал результатов, можно повторить. 
3 неделя

(14-21 день)

Клетки подрастают с каждым днем. Полностью переселяются в матку. Физические нагрузки и кормление остается на прежнем уровне. 
4 неделя

(21 28 день)

В зависимости от опыта заводчика можно с помощью пальцев нащупать щенков. Всегда можно обратиться к ветеринару. Набухают соски, из влагалища начинаются небольшие выделения прозрачного цвета. Ограждаем собаку от физических нагрузок, тренировок и игр. Ветеринар подскажет, какое должно быть питание на этапе 4 недели. 
5 неделя

(28-35 день)

Увеличивается количество околоплодных вод. У щенков формируются лапы, когти, усы. Сука в этот период активно набирает вес. Кормление рекомендуют частое, но небольшими порциями. Можно сделать УЗИ, чтобы определить на ранних сроках дефекты развития и, в крайнем случае, прервать беременность. 
6 неделя

(35-42 день)

Интересное положение становится очевидным для всех окружающих и без теста на беременность. У щенков формируется окрас и пигментация шерсти. Хозяевам пора приступать к изготовлению лежака. Теперь укладывать будущую мамочку нужно только в этом месте. 
7 неделя

(42-49 день)

У суки начинается линька. В это время щенки считаются полностью сформированными. Нужно давать специальный корм в таких количествах, что может съесть собака за один раз. Обязательно введите в рацион животного кальций. 
8 неделя

(49-57 день)

С этого момента щенков можно ждать в любой момент дня и ночи. Категорически запрещаются упражнения и другие стимуляции родов. К концу этого периода начинает образовываться молозиво. Кормление собаки осуществляется в том же режиме. 
9 неделя

(57-65 день)

Роды неизменно близки. Раз они проходят в домашних условиях, значит все должно быть подготовлено. Чтобы хоть как-то контролировать процесс, начинайте измерять температуру несколько раз в день. Кормление в том же режиме. Если происходит задержка свыше 60 дней, проводим процедуру контроля не только днем, но и ночью. Посмотрите на фото новорожденных щенков. 

Вот так по дням проходит весь процесс, когда питомица вынашивает щенков. Беременность собаки проходит быстро, но в этот период нужно быть предельно внимательным и острожным.

Особенности беременности

Это время нельзя считать болезнью. Собаку нужно также постоянно выгуливать. Чем больше срок, тем прогулки должны стать короткими, но частыми. Главное, наблюдать за состоянием физическим и психологическим. При малейших отклонениях от нормы стоит немедленно обратиться к ветеринару.

Календарь-калькулятор

Чтобы хоть как-то попытаться распланировать роды и узнать приблизительное их наступление поможет календарь-калькулятор. Он составляется с учетом того, что средний период беременности протекает за 62 дня. Дополнительно такой календарь поможет сориентироваться, когда примерно наступит день родов.

Сколько щенков вынашивает собака в животе?

Для того, чтобы понять, какое количество щенков у питомицы, стоит вспомнить о породе. У мелких особей помет намного отличается от крупных собратьев. Большие породы могут произвести на свет 10 и более щенков.

Для того, чтобы узнать точные сведения, нужно отправиться к врачу-ветеринару. Раз уж он может без теста сказать, что собака беременна, то и с легкость нащупает количество всех особей. К тому же на помощь всегда придет УЗИ.

Уход за собакой в положении

  1. Правильное питание. В рационе должна быть не только домашняя пища, но и специальные корма с витаминными добавками. Особенно ценно наличие кальция.
  2. Если все-таки выбор делается в пользу натуральной пищи, то увеличьте количество мяса, творога и субпродуктов.
  3. В первые недели не отказывайте любимице в удовольствии бегать, прыгать. А вот с середины первого месяца лучше прекратить физические упражнения и тренировки и дать питомице насладиться спокойствием.
  4. Нельзя собаку перекармливать.
  5. Круглосуточный доступ к свежей питьевой воде.

Уход за беременной собакой практически мало чем отличается от человеческого.

Прерывание беременности

Бывает такое, что вязка собаки вовсе не запланирована хозяином. В таких случаях приходится обращаться к такой процедуре, как аборт. Прервать беременность можно также по медицинским показаниям ветеринара. Процедуру проводят в независимости от срока беременности. Для начала стоит узнать была ли вязка. Делают специальный анализ влагалища собаки.

Неважно, какая стадия щенности у собаки, ветеринар сделает консервативное лечение. Его вид зависит от срока беременности:

  1. Первый месяц. Аборт затруднен по причинам неясности картины. Чаще всего в этот срок используют медикаменты.
  2. Конец первых недель. Тест на беременность будет уже точно положительным. Плоды высасывают или изгоняют из живота питомицы.
  3. Середина и конец второго месяца. Ветеринар сначала проводит кальцификацию костей щенят, а потом просто их изгоняет из утробы матери.

Извините, в настоящее время нет доступных опросов.

Видео «Беременные собаки»

В ролике рассказывается, что беременность и собака в доме – это счастье.

Беремнность собак: признаки, длительность, уход

    Беременность у собак — важный этап в жизни животного, связанный со стрессом для организма и серьезной перестройкой его жизнедеятельности. В ветеринарии вместо термина «беременность» предпочтительнее использовать другое наименование этого физиологического состояния — «щенность». Беременные собаки требуют особого ухода и присмотра хозяина, от которого во многом зависит успешность предстоящих родов.

    Сколько длится беременность у собак

    Длительность щенности у собак варьируется в пределах от 56 до 72 суток. Срок вынашивания потомства может иметь некоторую зависимость от размеров собаки и ее породы. Чем раньше от срока расчетов появились на свет щенки, тем они будут менее жизнеспособны. Нормой считается начало родов на 60-66 сутки беременности.

    Если этого не произошло в означенный период, есть смысл обратиться за консультацией к ветеринару, чтобы он установил наблюдение за животным. Роды у сук молодого возраста могут наступить раньше. Продолжительность вынашивания потомства также может зависеть от количества щенков. Если щенков мало, беременность может наступить чуть позже срока, рассчитанного владельцем.

    Как определить беременность

    Определить признаки беременности у собак на раннем этапе — задача вполне посильная для внимательного собаковода. Обычно увеличение объема живота происходит только на втором месяце вынашивания. На первом месяце следует обратить внимание на следующие пункты:

    • Обращайте внимание на аппетит собаки. Большинство беременных сук на ранней стадии вынашивания плода теряют аппетит и едят меньше, чем обычно. Однако не всегда потеря аппетита является признаком беременности. К тому же не все собаки проходят этап потери интереса к еде.
    • Поведение. Некоторые собаки в первые недели беременности начинают чувствовать себя хуже — они могут стать апатичными, вялыми, медлительными и неэнергичными. Если собака обычно игривая и энергичная, а спустя какое-то время после вязки она стала больше спать и с неохотой отзываться на команды, возможно, она забеременела. На первых неделях вынашивания собака может стать более ласковой и общительной. Может возникнуть и противоположная ситуация — питомец будет искать уединения в укромных местах.
    • Обратите внимание на размеры сосков собаки — у некоторых особей они могут увеличиться уже на 2 неделе беременности. Кожа на сосках становиться толще, а у собак, беременных не в первый раз, соски могут начать свисать.
    • Если вы регулярно посещаете ветеринара, можно определить беременность по содержанию в крови релаксина. Это вещество вырабатывается в организме собаки на 3 неделе беременности.
    • На втором месяце беременности аппетит собаки может значительно увеличиться.
    • Плоды можно прощупать пальпацией на 3-4 неделях. Они находятся по обеим сторонам живота суки в виде плотных комочков. Позже потомство прощупывается с трудом.
    • Начинает расти и становиться упругим живот, соски набухают, наполняясь молоком.
    • На этой стадии из вагины собаки могут появляться бесцветные или бледные выделения.
    • Ближе к концу второго месяца беременность собаки становиться очевидной. Если щенков много, живот может мешать собаке при передвижении. К 45 дням можно сделать рентгенографию и определить количество приплода.

    Признаки приближения родов

    Собака начинает некомфортно себя чувствовать, не сидит на одном месте, хаотично передвигается по комнате. Часть собак может держаться к хозяину поближе, части, наоборот, ищет уединения. В последний день-два перед родами собака начинает искать безопасное место для выводка. Если хозяин предоставляет ей комфортные условия для родов, собака может лечь туда и уже не вставать до самого начала процесса.

    Советы по уходу за беременными собаками

    Далее мы постараемся описать данный процесс по периодам, чтобы каждый хозяин мог подготовиться.

    Меры безопасности

    На первом месяце беременности не рекомендуется держать собак на руках животом вверх. Это может привести к перекручиванию маточных рогов. Также нельзя позволять собакам спать на спине. Не рекомендуется прощупывать суку на 5-6 неделях беременности. У молодых сук, беременных впервые, лучше вообще не щупать живот.

    Держите детей подальше от беременной собаки — во время вынашивания животное может стать нервным и склонным к агрессии. Не стоит подпускать к собакам незнакомых людей и других собак. К окончанию срока беременности и в первые дни после родов следует соблюдать осторожность и самому хозяину — защищая потомство, собака может укусить и его.

    Физические нагрузки

    До 40-45 дней беременности сука должна больше гулять и двигаться, хотя как раз в этот период собака может стать склонной к лени. Насиловать собаку не стоит, но старайтесь гулять с ней подольше — это необходимо для укрепления мышц и, следовательно, способствует более удачным родам.

    Правильные физические нагрузки — залог безболезненных и быстрых родов. Кроме того, физическая активность несколько замедляет рост щенков, что тоже способствует облегчению родов. Рост щенки могут набрать потом, во время кормления молоком. Снижать нагрузки следует дней за 20-25 перед родами, когда щенки начинают толкаться. За неделю до родов можно вообще прекратить такие физические нагрузки, как бег и прыжки.

    Питание

    Питание щенной собаки должно состоять из высококачественных продуктов, а содержание белка и кальция должно быть повышено по сравнению с обычным рационом. Лучший источник белка — сырое (но обработанное кипятком и безопасное) мясо и субпродукты, лучший источник кальция — творог (особенно, если в рацион нет костей). Это основа диеты беременной собаки. При использовании натуральных продуктов, риск передозировки каких-либо элементов снижается. Если в обычное время вы кормите собаку специальными кормами, то не стоит вовсе прекращать давать его — просто существенно увеличьте долю естественного питания.

    Во время вынашивания щенков в теплое время года нужно больше бывать с собакой на свежем воздухе, увеличивая продолжительность солнечного воздействия (это способствует выработке витамина D). Необходимы также фолиевая кислота (ее много в зелени, особенно в спарже, малиновых листьях, брокколи и т.д.) и витамин Е (его в большом количестве содержит яичный желток).

    На втором месяце беременности есть смысл увеличить долю естественных кормов с добавлением витаминов и рыбьего жира в рационе собаки. Давать ли ей искусственные добавки с минералами — на этот вопрос вам лучше ответит опытный ветеринар.

    Избавление от паразитов и гигиена

    Проводить глистогонные процедуры и удаление внешних паразитов следует до начала вязки, примерно за 2 недели. Глистогонные средства, данные во время беременности, могут привести к выкидышу. Если заражение все же происходит во время беременности, то используйте мягкие и щадящие лекарственные средства. Во время вынашивания следует следить за состоянием шерсти, зубов и слуховых проходов собаки.

    Ложная беременность

    Данное физиологическое состояние может возникнуть у сук, которые не были повязаны. Во время ложной беременности у собаки возникают все признаки поведения, характерные для щенности. Собака может начать готовить гнездо и даже испытывать нечто похожее на родовые схватки. При этом у нее может начаться выработка молока. Такому животному может потребоваться терапия успокоительными средствами, которые назначит ветеринар.

    Через какое-то время собака возвращается в нормальное состояние. Ложная беременность обычно никак не влияет на возможность реальной щенности в будущем. Причинами ложной беременности ветеринарная медицина считает избыточное либо неравномерное выделение специфических гормонов в организме собаки. В норме этот нейрогормон производится только после оплодотворения яйцеклетки. Иногда ложная беременность возникает при воспалительных процессах и скоплениях гноя в матке.

    И давайте все прочитанное закрепим видео-роликом, которые разложит все полученные знания по полочкам. Смотрите:

    youtube.com/v/fpXdw_IqYnk?version=3&hl=ru_RU»/>

    Пусть ваша собака выведет здоровых щенят. Здоровья им.

    Два месяца длится беременность у собак, и заканчивается рождением щенков

    Беременность у собак обычно в среднем, длится шестьдесят дней, но эта цифра не точна, так как физиологические процессы сугубо индивидуальны, и у разных особей длительность вынашивания щенков может составлять от пятидесяти шести до семидесяти трех дней. Более долгий срок опасен возникновением осложнений, поэтому собака, перехаживающая беременность, нуждается во врачебном осмотре, и возможно, операции.

    Признаки беременности у собак

    Сразу после вязки невозможно определить, беременна сука или нет, так как животное практически не меняется в поведенческих реакциях, оно так же активно. Через две недели у некоторых сук может возникнуть подавленное состояние, потеря аппетита и сонливость. Это абсолютно нормальное состояние при условии, что кровянистые выделения из петли прекратились.

    В период до четырех недель у щенной суки набухают соски: они становятся более крупными, ярко-розовыми. В остальном поведение и внешний вид животного не изменяется, у него прекрасный аппетит и сон, оно с удовольствием занимается и играет. В это время владелец должен увеличить число кормлений до трех в сутки, увеличив объем белка в пище за счет мясных и молочных продуктов.

    Начиная со второго месяца беременности, опытный владелец уже может заметить увеличение живота собаки в области ребер. Особенно это заметно, когда животное сидит. Молочные железы продолжают увеличиваться, набухать, сука становится менее подвижной, избегает резких прыжков.

    За две-три недели до предполагаемого срока родов, сука начинает быстро увеличиваться в объеме, живот растет прямо на глазах. В лежачем положении уже заметно, как в животе толкаются щенки. Кормить собаку необходимо дробно, малыми порциями, не перекармливая. Прогулки необходимы, но только шагом, без нагрузок.

    Различия в протекании беременности у собак

    Беременность у различных пород
    собак протекает одинаково

    • Первая беременность собаки проходит практически так же, как и последующие, только признаки щенности проявляются немного позже, чем у рожавших сук. Молоко у рожавшей впервые суки тоже появляется только за день до родов, или в тот же день.
    • Беременность у собак мелких пород протекает точно так же, как у представителей крупных и средних пород, различия могут быть лишь в поведении животных. Собаки мелких пород обладают более хрупкой и тонкой нервной организацией, поэтому все поведенческие реакции у них могут быть более выражены.
    • Старые животные чаще перехаживают, у них более выражены такие признаки недомогания на поздних сроках, как отдышка и отеки лап, поэтому они нуждаются в особом питании и уходе.

    Первые симптомы чумки у собак. Лечение и профилактика чумки.

    Как правильно применять травматин при лечении собаки читайте в этой статье.

    Ложная беременность у собак

    Иногда бывает, что после вязки или очередной течки, в которую собака не вязалась, у нее возникают такие признаки беременности, как увеличение молочных желез, лактация и изменение поведения. Это связано с нарушением гормонального фона животного, и называется ложная щенность или мнимая (ложная) беременность.

    Симптомы и признаки ложной беременности у собак в первые недели после течки, несколько схожи с признаками настоящей щенности: у суки наблюдается изменение в поведении и увеличение сосков. Изменение аппетита, вялость и задумчивость – эти признаки говорят владельцу о том, что животное беременно. Соответственно, хозяин увеличивает рацион и ограничивает нагрузки суки.

    Но через шесть недель ожидаемого увеличения живота не происходит, как и родов через шестьдесят дней, зато поведение собаки говорит о том, что она стала матерью: сука строит гнезда из подстилки, носит туда игрушки и подолгу вылизывает соски. В некоторых случаях собака сосет молоко сама у себя, что еще больше усугубляет ситуацию.

    При ложной щенности сука строит
    гнездо из подстилки

    Если беременность на самом деле ложная, что можно проверить, сделав суке УЗИ на четвертой неделе щенности, то необходимо принимать срочные меры. Животному увеличивают физические нагрузки, устраивают длительные прогулки, урезают рацион. Из питания убирают все молочные продукты, уменьшают количество белка, ограничивают потребление жидкости.

    Для лечения ложной беременности у собак можно применять лекарственные препараты, нормализующие гормональный фон, например Бромокриптин. Если сука не представляет племенной ценности, то лучше всего произвести стерилизацию, так как постоянные периоды лактации могут привести к образованию опухолей молочных желез.

    Календарь беременности у собак, беременность по дням

    • 1-14 день от первой вязки – зародыши прикрепляются к стенкам матки, образуется плацента.
    • 15-20 дни – важнейший этап: формируются внутренние органы плодов, нервная система и формирование позвоночника. Самое ответственное время, когда любое применение лекарственных средств или препаратов от блох может вызвать уродства плодов, а сильный стресс спровоцировать выкидыш.
    • 21-29 дни – время для УЗИ диагностики щенности, когда формирование плаценты закончено, и щенки крупных пород достигают размера одного-двух сантиметров.
    • 30-40 день – начало второй половины беременности, врач и опытные заводчики могут определить беременность суки, пальпируя живот.
    • 40-45 день – у щенков полностью сформированы внутренние органы, они начинают интенсивно расти, поэтому рацион суки должен быть достаточным для удовлетворения всех потребностей растущих детей. Ее переводят на дробное питание с большим количеством молочных и мясных продуктов.
    • 45-50 дни – живот беременной собаки хорошо заметен и увеличивается с каждым днем, уже можно прощупать щенков через брюшную стенку. Они к этому времени вырастают до двенадцати сантиметров, и уже покрыты шерстью.
    • 51-58 дни – у собаки начинает появляться молоко, она много отдыхает, ест с удовольствием. Щенки вырастают до пятнадцати сантиметров.
    • 59-64 дни – сука начинает беспокоиться, периодически возникают небольшие спазмы маточной мускулатуры, собака может порвать подстилку, устраивая гнездо. Щенки уже полностью готовы к рождению.

    Беременность у здоровых собак обычно протекает нормально, не причиняя беспокойств владельцам, и через два месяца после вязки суки обычно рожают здоровых щенков.

    Как правильно как построить будку для собаки своими руками читайте на нашем сайте.

    Узнайте, почему могут гноиться глаза у Вашей собаки в этой статье.

    Как избавиться от власоедов – http://vseprosobak.ru/zdorove-sobaki/zabolevaniya/u-sobaki-poyavilis-vlasoedy.html

    В заключение смотрите видео сюжет о беременности у собак:

    Похожие записи

    Старение плода у собак и кошек – тематическое ветеринарное исследование мелких животных

    Старение плода у собак и кошек

    У собак есть два основных измерения, которые можно выполнить для оценки возраста плода. В этом контексте термин «гестационный возраст» относится к количеству дней после всплеска лютеинизирующего гормона (ЛГ), при этом средняя продолжительность беременности составляет 65 дней.

    Первый метод включает измерение диаметра плодного яйца и является более точным на ранних сроках беременности (до 40-го дня).

    Второй метод определения возраста плода включает измерение диаметра головки плода. Этот метод следует использовать для оценки возраста плода на поздних сроках беременности (после 40-го дня).

    Формулы для этих методов следующие (все измерения даны в сантиметрах):
    Гестационный возраст = (6 x диаметр плодного яйца) + 20
    Гестационный возраст = (15 x диаметр головы) + 20

     

    Рис. 1: Ультразвуковое изображение плода собаки, демонстрирующее измерение диаметра головы.

    Таким образом, количество дней, оставшихся до родов, можно определить путем вычитания расчетного гестационного возраста из 65.

    Рост плода происходит линейно с 17 по 30 день, а затем становится экспоненциальным. Другими словами, мелкие породы будут расти медленнее, а гигантские — быстрее после 30-го дня.

    Однако рост плода у самок, масса тела которых в небеременном состоянии находится в диапазоне 9-40 кг, менее изменчив.

    Поэтому при определении возраста плода собаки с помощью ультразвука следует помнить несколько моментов:

    • Измерения и расчеты более точны, если они выполняются на ранних и средних сроках беременности (примерно на 30-й день)
    • Измерения следует проводить не менее чем на 2 плодах
    • У собак мелких пород (<9 кг) к рассчитанному сроку беременности добавить 1 день
    • У собак гигантских пород (>40 кг) вычтите 2 дня из расчетного гестационного возраста
    • Следует избегать установления определенного размера помета!!!

    Старение плода кошки

    Для старения кошачьего плода значение средней продолжительности беременности составляет 61 день.Как и в случае с плодом собаки, при оценке возраста котят можно использовать как диаметр плодного яйца, так и диаметр головы.

    До 30-го дня (измерение в миллиметрах):

    Гестационный возраст = (1,0901 x диаметр плодного яйца) – 0,9372
    После 30-го дня (измерения в сантиметрах):
    Гестационный возраст = (25 x диаметр головы) + 3

     

    (ГСД). Поскольку плодный мешок не всегда идеально круглый, проводят два измерения, и в формуле расчета гестационного возраста используется среднее значение GSD.

    Оценка жизнеспособности плода

    Ультразвуковая визуализация также полезна для выявления дистресса или смерти плода. Движение плода и наблюдение за сердцебиением плода (с использованием или без использования цветного допплера) являются параметрами, которые не могут быть идентифицированы на рентгенограмме.

    Частота сердечных сокращений плода обычно в два раза выше, чем у матери или матки. Снижение частоты сердечных сокращений плода может указывать на то, что щенок или котенок находятся в бедственном положении, например, при гипоксии, вторичной по отношению к дистоции.

    Рис. 3: Ультразвуковое изображение плода кошки, демонстрирующее кровоток через сердце с помощью цветного допплера. Сердцебиение также можно легко визуализировать на «живом» черно-белом изображении без использования допплера.

     

    Каталожные номера

    Куцлер, М.А., Йегер, А.Е., Мохаммед, Х.О. и Мейерс-Валлен, В.Н. (2003). Точность прогнозирования даты родов у собак с использованием измерений плода, полученных с помощью ультразвукового исследования. Териогенология 60:1309-1317.


    Найланд, Т. Г. и Маттун, Дж. С. (1995). Ветеринарное ультразвуковое исследование. В.Б. Компания Saunders, Филадельфия.


    О’Брайен Р. и Барр Ф. (ред.) (2009 г.). Руководство BSAVA по абдоминальной визуализации собак и кошек. Британская ветеринарная ассоциация мелких животных, Глостер.

    РАСЧЕТ ГЕСТАЦИОННОГО ВОЗРАСТА СОБАКИ

    Один из наиболее частых вопросов, задаваемых специалистам УЗИ, выполняющим сканирование беременных, особенно собак, — это срок родов. В породах, у которых роды могут быть трудными, важно знать, когда должна родить сука, чтобы мог присутствовать владелец, или заранее подготовиться к кесареву сечению.

    Исследование Kutzler et al. (2003) обнаружили, что сроки родов можно предсказать с помощью ультразвука в течение 24 часов с точностью 75% и в течение 48 часов с точностью 87%. Это связано с тем, что эмбрион собаки растет со скоростью 1 мм в диаметре в день в течение 17-30 дней, после чего скорость роста становится экспоненциальной.Точность стандартных мерок можно повысить, сделав поправку на размер породы; +1 день для мелких (менее 9 кг) и -2 дня для гигантских (более 40 кг) пород. Принимая во внимание, что данные для этого исследования были собраны в период с 1987 по 2001 год, у ветеринаров и заводчиков, приобретающих современное оборудование, не должно возникнуть трудностей с достижением аналогичных показателей успеха.

    Катцлер и др. (2003) рекомендуют проводить измерения как минимум у двух плодов (если только не присутствует только один) и обнаружили, что оптимальное время для измерения — 30-й день. Прогнозы, сделанные после 39 дней беременности, могли использовать только биариетальные и BD измерения плода, и их точность составляла менее 50% в пределах двухдневного допуска.

    Очень похожие показатели точности были получены Lenard et al. (2007), которые обнаружили, что хорошей заменой измерениям на поздних сроках беременности (которые оказались слишком неточными) является поиск маркеров развития органов. Преимущество этого метода также в том, что ему не нужно приспосабливаться к размеру матери и породы. Единственным недостатком сканирования на 30-й день является то, что резорбция все еще может происходить; однако, пока не делаются прогнозы размера помета, это не должно быть серьезной проблемой.

    Полезными маркерами развития являются:

    День 23-24: Наблюдается сердцебиение плода

    День 25-28: плод меняет форму с круглой на биполярную

    День 27-31: В голове развивается анэхогенная (темная) область

    День 33-35: развиваются зачатки конечностей

    День 34-36: теперь можно увидеть движение плода

    Таким образом, при использовании пакетов для расчета гестационного возраста вашего сканера помните следующее:

    — «С 20-го по 25-й день диаметр эмбрионального пузырька (EVD) является единственным измерением плода, которое можно сделать. »

    — «Эмбрион становится видимым на 26-й день, и с этого дня можно измерять длину от темени до крестца (CRL) и диаметр тела (BD)».

    — «С 26-го по 29-й день CRL измеряли как общую длину эмбриона, а BD измеряли в одной плоскости».

    Взято из Kutzler et al. (2003).

    Используя любой из этих методов расчета гестационного возраста на соответствующем этапе беременности и с поправкой на размер породы, вы можете точно предсказать дату родов, но не в 100% случаев.Неточности в размещении калипера или тот факт, что собаки могут рожать преждевременно или с опозданием, означают, что добиться правильного результата в 100% случаев просто нереально.

    Возможно, хорошей отправной точкой для тех, кто увлечен оценкой гестационного возраста, было бы предоставление владельцу даты с допуском в 72 часа и обязательное уточнение даты родов. Если выяснится, что это постоянно происходит в течение 48 часов после указанной даты, техник может начать давать владельцам 48-часовые окна с четко сформулированной оговоркой, что их собака не машина, и что нельзя полагаться на дату родов. как гарантировано.

    Дополнительное чтение:

    Для более раннего обсуждения ориентиров во время беременности нажмите здесь.

    Чтобы получить справку по расчету гестационного возраста с помощью ультразвукового аппарата Teknova TH80v, нажмите здесь.

    Чтобы рассчитать срок беременности с помощью Scan Pad, сканирование должно выполняться в акушерском режиме. Для этого нажмите «FUNCTION», затем «PROBE» и выберите настройку «OB». После того, как вы зафиксировали свое изображение, вы переходите к «ФУНКЦИЯ» и «ИЗМЕРЕНИЕ» обычным способом, но внизу слева вы увидите все доступные пакеты расчета гестационного возраста.

    Оценка гестационного возраста и оценка созревания плода собак с помощью радиологии и ультразвукового исследования: обзор

    Продолжительность беременности у сук относительно короткая по сравнению с другими домашними породами и длится всего 63 дня от овуляции. Таким образом, плоды рождаются в незрелом состоянии, и окончательное развитие большинства систем органов завершается в течение недель или месяцев после рождения. Следовательно, значительное развитие основных систем органов плода происходит в последние дни беременности в рамках подготовки к внеутробному выживанию.Неспособность плода завершить созревание приведет к его неспособности выжить после родов. Кроме того, из-за особенностей собачьей плаценты, как только плод превышает срок родов более чем на 2 дня, ему потребуется больше питательных веществ, чем может обеспечить плацента, что приведет к внутриутробной гибели плода. Таким образом, крайне важно убедиться, что каждый плод достиг, но не превысил своего максимального гестационного возраста до родов.

    В некоторых ситуациях необходима оценка гестационного возраста и созревания плода; большинство из них возникает при неадекватном времени овуляции или его отсутствии, чтобы можно было определить точную дату родов.

    Суки, которым разрешено рожать естественным путем, но которым может потребоваться ветеринарная помощь во время родов. Это позволяет заводчику и ветеринару быть готовыми к началу родов.

    Суки, которым желательно плановое кесарево сечение, т.е. одноплодные, суки гигантских пород с маленьким пометом и, следовательно, очень крупными щенками, суки с очень большими пометами, у которых инертность матки вызывает беспокойство из-за ожидаемой продолжительности роды или суки с предшествующей дистоцией или первичной вялостью матки.При одноплодной беременности может быть недостаточное выделение кортизола плодом для инициации продукции простагландинов F эндометрием, что вызывает лютеолиз, который, в свою очередь, инициирует роды.

    Суки с высоким риском беременности, включая гестационный сахарный диабет или токсикоз беременных, или суки, нуждающиеся в добавлении прогестерона из-за лютеиновой недостаточности в результате хронического эндометрита, стресса, частичного аборта или идиопатической лютеиновой недостаточности.В случаях беременности с высоким риском суку часто поддерживают на максимально возможном сроке беременности, пытаясь довести плод до срока. В некоторых случаях продолжение может оказаться невозможным из-за неудовлетворительного состояния здоровья суки; в этих случаях плод может не выжить, если он должен родиться раньше срока. В других случаях беременности с высоким риском из-за хронического воспаления, сопутствующей пиометры или другого стрессора суке можно давать дополнительный прогестерон для поддержания беременности до срока, если концентрация прогестерона снижается преждевременно.

    Суки, у которых начались преждевременные роды из-за аномалий или дефектов миометрия, вызванных питанием, окружающей средой, травматическими или воспалительными причинами, или в случаях, когда роды прерываются из-за использования токолитиков ( тербуталин и/или прогестерон).

    В каждой из предыдущих ситуаций, как правило, нет никаких предупреждений о проблеме до тех пор, пока сука не будет осеменена и не подтверждена беременность. Если время овуляции отсутствует или является неадекватным, необходимость определения гестационного возраста и созревания становится решающей для положительного результата.

    Продолжительность беременности наиболее точно определяется с помощью выброса ЛГ или овуляции. Роды происходят через 65 ± 2 дня после выброса ЛГ, а овуляция происходит через 2 дня после выброса ЛГ [1], [2], [3], [4]. Из-за чрезвычайной изменчивости продолжительности эстрального цикла и рецептивного поведения суки, а также продолжительности жизни сперматозоидов в репродуктивном тракте суки использование дат вязки не является точным методом оценки гестационного возраста [1], [2]. , [4]. В связи с этим роды могут происходить от 58 до 71 дней после осеменения [1], [2], [4], [5].

    В этом документе рассматривается использование рентгенографии и ультрасонографии для определения гестационного возраста и оценки созревания плода у сук. Все оценки и расчеты гестационного возраста и созревания плода в этой статье выражены в днях после всплеска ЛГ, если не указано иное.

    Оценка гестационного возраста и оценка созревания плода у собак с использованием радиологии и УЗИ: обзор.

    ПОКАЗАНЫ 1-10 ИЗ 32 ССЫЛОК

    СОРТИРОВАТЬ ПОРелевантности Наиболее влиятельные документыНедавность

    Диагностика здоровья плода собаки с помощью ультразвукового исследования.

    Выявление патологии плода имеет важное значение для ухода за щенками в послеродовом периоде. Целью данного исследования было определение параметров дистресса плода путем определения частоты сердечных сокращений плода… Развернуть

    • Посмотреть 4 выдержки, библиография

    Диагностика здоровья плода собаки с помощью ультразвукового исследования.

    В заключение, ультразвуковое исследование позволило идентифицировать плоды с задержкой внутриутробного развития, а движения кишечника были надежным индикатором дистресса плода; предполагается, что эти состояния указывают на больший перинатальный риск.Expand

    РЕНТГЕНОВСКАЯ ОЦЕНКА ПРЕНАТАЛЬНОГО РАЗВИТИЯ У БИГЛЕЙ

    Между собаками наблюдаются большие различия в сроках беременности, если они основаны на времени осеменения, а не на появлении пика ЛГ или родов, а также на датах, когда рентгенографически можно обнаружить увеличение матки или минерализация плода определялась более точно. Expand
    • View 2 выдержки, ссылки методы и предпосылки

    Ультрасонографическое исследование во время беременности роста энцефалической части плода собаки

    Целью настоящего исследования была ультразвуковая оценка роста DPTV во время беременности у сук разного размера и оценка пригодности измерения DPTV по сравнению с измерением внутреннего диаметра хорионической полости (ICC) и бипариетального диаметра (BP), которые обычно используются для прогнозирования дня родов у этого вида. Expand
    • Посмотреть 4 выдержки, справочная информация и методы

    Предсказание даты родов при беременности собак.

    В этом обзоре анализируются методы, которые можно использовать для точного прогнозирования дня родов, и делается вывод о том, что с помощью ультразвуковых измерений внеплодных и эмбриональных структур можно сделать точный прогноз как на ранних, так и на поздних сроках беременности. Expand
    • Просмотреть 10 выдержек, справочных материалов, методов и общих сведений

    Подсчет эмбрионов Радиология – современная ветеринарная практика

    Основы визуализации, радиология/визуализация


    Мэтью Райт, DVM, MS, Diplomate ACVR

    Хотя рентгенограммы плода важны при планировании щенения, у владельцев домашних животных возникают вопросы о рисках, связанных с облучением.


    Радиографические процедуры подсчета плода обычно выполняются в ветеринарии. Эти исследования проводятся на поздних сроках беременности животного и позволяют ветеринару или ветеринарному технику подсчитать количество присутствующих плодов.

    Заводчикам и владельцам домашних животных часто необходимо точно оценить количество присутствующих плодов до родов. Точный подсчет плода:

    • Облегчает лечение в случаях задержки плода (мертвый плод)
    • Позволяет проводить раннее вмешательство в случаях дистоции.

    Хотя эти процедуры важны при планировании родов, заводчики и владельцы домашних животных ставят под сомнение безопасность этой процедуры в связи с рисками, связанными с радиационно-индуцированным канцерогенезом.

    ПОЧЕМУ НЕ УЛЬТРАЗВУК?

    В медицине оценка состояния плода проводится с помощью диагностического ультразвука. Тем не менее, большинство опытных рентгенологов согласны с тем, что диагностическое ультразвуковое исследование брюшной полости является плохим предиктором числа плодов у видов, которые несут помет. 1

    Ультразвук неточен для оценки числа плодов, потому что:

    • В одной плоскости сканирования отображается только небольшая часть матки
    • Плоды могут учитываться более одного раза или не учитываться вовсе.

    Из-за этих ограничений ультразвука рентгенографическая оценка является единственным практичным и легкодоступным методом подсчета плодов в ветеринарии. 2

    ПОНИМАНИЕ РАДИАЦИОННОГО ВОЗДЕЙСТВИЯ

    Чтобы понять риски, связанные с радиационным облучением плода, ветеринарный врач и ветеринарный техник должны иметь представление о дозе радиации, используемой во время процедуры подсчета плода.Однако единицы, используемые для описания радиационного облучения, могут сбивать с толку.

    В этом обсуждении все единицы будут преобразованы в миллибэр  (мбэр). Эта единица радиационного облучения наиболее знакома членам ветеринарной бригады. Размышляя о рисках и преимуществах визуализации подсчета плода, имейте в виду, что экспозиция на одной боковой рентгенограмме живота, оцененная по экспозициям, описанным в медицине, составляет от 30 до 50 мБэр.

    ПОДСЧЁТ ПЛОДА РАДИОЛОГИЧЕСКИЕ РИСКИ

    Неканцерогенное воздействие радиации на плод зависит от гестационного возраста и дозы облучения.

    Срок беременности.  У людей эмбриональная гибель и врожденные пороки развития, скорее всего, происходят в результате радиационного облучения в течение первых 6 недель беременности. Таким образом, у человека эмбриональная гибель обычно происходит в преимплантационном периоде (0–9 дней), а пороки развития обычно возникают в период органогенеза (10 дней–6 недель). Воздействие на центральную нервную систему проявляется в раннем внутриутробном периоде (6-недельный срок) с максимальной чувствительностью в период от 8 до 15 недель.

    Доза радиации.  Хотя у нас нет данных о пациентах-собаках, в медицине человека:

    • Общество физики здоровья заявляет, что уровень радиационного облучения, используемый в большинстве диагностических процедур (< 5 рад или 5000 мбэр), не увеличивает неканцерогенные репродуктивные риски (врожденные дефекты или выкидыш) на любой стадии беременности у людей. 3
    • По данным Комиссии по ядерному регулированию США, максимально допустимый предел дозы для человеческого эмбриона/плода составляет:
      • 500 млн бэр в течение 9 месяцев
      • Максимум 50 млн бэр в месяц.
    • Дозы ниже указанных выше считаются допустимой дозой радиационного облучения человеческого эмбриона/плода. 4
    • Центры по контролю и профилактике заболеваний (CDC) рекомендуют, что радиационно-индуцированные неканцерогенные последствия для здоровья человека маловероятны при дозах менее 0,50 Гр (50 рад или 50 000 мбэр) в период от 16 недель беременности до рождения. 5

    Эта информация показывает, что радиационное облучение от единственной боковой проекции живота (≈ 30–50 мБэр) намного меньше, чем 50 000 мБэр, и, следовательно, оценка числа плодов сопряжена с небольшим риском неканцерогенных побочных эффектов (аномалий развития или выкидышей). ) плоду при проведении на поздних сроках беременности.

    Хотя данные о пациентах-собаках отсутствуют, CDC сообщает, что у людей: 5

    • Расчетная заболеваемость раком у детей, подвергшихся облучению во время диагностических рентгенографических процедур (0–5 рад или 0–5000 мбэр), составляет от 0,3% до 1%
    • Расчетная заболеваемость раком в течение жизни у этих же пациентов составляет от 38% до 40%.

    Важно отметить, что:

    • Расчетная заболеваемость раком у детей, не подвергшихся воздействию радиации (выше уровня фонового излучения), равна 0.3%
    • Расчетная заболеваемость раком в течение жизни у людей, не подвергшихся облучению, составляет 38%.

    Таким образом, у пациентов-людей, подвергшихся воздействию низких уровней радиации внутриутробно, наблюдается лишь небольшое увеличение (< 1%) заболеваемости раком у детей и небольшое увеличение (< 2%) заболеваемости раком в течение жизни.

    Кроме того, верхняя граница диапазона, использованного для приведенных выше оценок (5000 мБэр), намного превышает экспозицию при одной боковой рентгенографической проекции брюшной полости (50 мБэр).К сожалению, у нас нет данных, оценивающих риск рака у собак (или людей) по одной боковой проекции живота.

    Рисунок 1. На этом изображении показано осложнение беременности — газ в матке и мацерированный плод.

    РИСК ПРОТИВ ПОЛЬЗЫ

    Учитывая, что любое радиационное облучение следует рассматривать как потенциально вредное, перед проведением подсчета плода необходимо провести анализ риска и пользы, а польза от проведения исследования должна перевешивать риски, связанные с облучением плода.

    В ветеринарии у нас нет экономичного или эффективного метода определения числа плодов без использования ионизирующего излучения. Как указывалось ранее, диагностическое ультразвуковое исследование не позволяет предсказать число плодов у потомственных видов.

    Для многих заводчиков и владельцев домашних животных польза от знания количества плодов до щенения перевешивает риск воздействия на плод ионизирующего излучения.

    Советы по точной оценке числа плодов

    Совет 1.Сделайте рентгенограммы на 55-й день беременности или позже. Основной ловушкой при подсчете плода является получение рентгенограмм до того, как плод полностью минерализуется.

    Совет 2. Используйте боковую проекцию для оценки числа плодов. В большинстве случаев боковая проекция обеспечивает наилучшую визуализацию плодов; вентродорсальная проекция требует более квалифицированной радиографической техники из-за большей толщины проекции, что может привести к рассеянию и снижению контраста, что затрудняет подсчет плода.

    Совет 3. Считайте головы. Считай шипы. Если они не совпадают — пересчитайте. Большое количество плодов в брюшной полости может сильно затруднить их отслеживание. Следовательно, если 2 числа совпадают, вы посчитали правильно. Если они не совпадают, вы либо пропустили плод, либо дважды подсчитали плод, либо возникла проблема с плодом.

    РЕКОМЕНДАЦИИ ПО РАДИОЛОГИЧЕСКОМУ ПОДСЧЕТУ ПЛОДА

    В более старых текстах сообщается, что минерализация плода может быть определена рентгенологически после 41-го дня.Однако минерализация прогрессирует в течение нескольких дней, и невозможно определить время оплодотворения у собаки (это может произойти через несколько дней после овуляции). Таким образом, получение рентгенограмм на 41-й день больше не является практической рекомендацией, поскольку позднее внесение удобрений приведет к неполной минерализации и неудачному радиографическому обнаружению.

    Рисунок 2.  Боковая (А) и вентродорсальная (В) рентгенограммы нормальной беременности; обратите внимание, что легче идентифицировать кости в латеральной, чем в вентродорсальной рентгенограмме.

    Рисунок 2-A

    Рисунок 2-В

    КРАТКИЙ ОБЗОР

    Хотя нельзя однозначно заявить об отсутствии риска повышения заболеваемости раком в течение жизни в результате рентгенографических оценок числа плодов, интерполяция данных медицины человека позволяет предположить, что, учитывая уровни радиации, использованные в этих оценках, риск связанный с этими исследованиями, низок по сравнению с преимуществами, полученными в результате процедуры.

    CDC = Центры по контролю и профилактике заболеваний; мбэр = миллибэр

    Каталожные номера
    1. Найланд Т., Маттун Дж. Ультразвуковая диагностика мелких животных . Филадельфия: В. Б. Сондерс, 2002.
    2. .
    3. Тоал Р.Л., Уокер М.А., Генри Г.А. Сравнение УЗИ в режиме реального времени, пальпации и рентгенографии при обнаружении беременности и определении размера помета у суки. Вет Радиол  1986; 27:102-108.
    4. Брент Р. Беременность и радиационное облучение. Доступно по адресу http://hps.org/hpspublications/articles/premityandradiationexposureinfosheet.html.
    5. Комиссия по ядерному регулированию США.Часть 20. Стандарты защиты от радиации. Правила NRC . Доступно по адресу nrc.gov/reading-rm/doc-collections/cfr/part020/full-text.html.
    6. Облучение и беременность: информационный бюллетень для клиницистов . Доступно на http://www.bt.cdc.gov/radiation/prenatalphysician.asp.

    Рекомендуемая литература
    • Brenner DJ, Doll R, Goodhead DT и др. Риски рака, связанные с низкими дозами ионизирующего излучения: оценка того, что мы действительно знаем.Proc Natl Acad Sci 2003; 100:13761-13766.
    • Долл Р., Уэйкфорд Р. Риск рака у детей в результате облучения плода. Бр Дж Радиол 1997; 70:130-139.
    • Лопате С. Оценка гестационного возраста и оценка созревания плода у собак с использованием радиологии и УЗИ: обзор. Териогенол, август 2008 г .; 70:397-402.

    Мэтью Райт , DVM, MS, Diplomate ACVR, штатный радиолог Idexx Telemedicine Consultants. Он является автором многочисленных книг, статей и образовательных серий по радиационной безопасности, в том числе «Радиационная безопасность для ветеринарного врача».Мнения, выраженные в этой статье, не обязательно отражают мнение его работодателя.

    Оценка гестационного возраста и оценка созревания плода у собак с использованием радиологии и ультразвукового исследования: обзор

    Точное прогнозирование даты родов у собак и кошек позволяет лучше управлять родами, снижая потери новорожденных. В этом обзоре оцениваются наиболее распространенные методы, используемые для точного прогнозирования дня родов: определение овуляции и гормональных анализов, первое появление структур эмбриона/плода с помощью ультразвука или рентгенографии, эхографическое измерение внеплодовых и фетальных структур или оценка потока плода. и частота сердечных сокращений.Определение овуляции и гормональных анализов во время осеменения и ближе к сроку беременности широко используется для прогнозирования родов у собак (Concannon et al. American Journal of Veterinary Research 44, 1983, 1819; Hayer et al. Journal of Reproduction and Fertility, Suppl., 47, 1993, 93; Hase и др., Journal of Veterinary Medical Science, 62, 2000, 243; Kutzler и др., Theriogenology, 60, 2003a, 1187). На кошках были проведены некоторые исследования, но гормональные параметры для точного прогнозирования родов пока не описаны (Buff et al.Журнал репродукции и плодородия, Suppl. 57, 2001, 187; Де Хаас ван Дорссер и др. Биология репродукции, 74, 2006, 1090; ДиГанги и др. Журнал Американской ветеринарной медицинской ассоциации, 237, 2010, 1267; Денхард и др. Териогенология, 77, 2012, 1088). Во многих исследованиях предполагалось, что время беременности может быть получено путем наблюдения с помощью УЗИ или рентгенографии определенных структур в зависимости от времени появления во время беременности (Concannon and Rendano American Journal of Veterinary Research, 44, 1983, 1506; Rendano et al.Ветеринарная радиология, 25, 1984, 132; Журнал Шилле и Гонтарек Американской ветеринарной медицинской ассоциации, 187, 1985, 1021; Дэвидсон и др. Ветеринарная радиология, 27, 1986, 109; Англия и др. Journal of Small Animal Practice, 31, 1990, 324; Йегер и др. Американский журнал ветеринарных исследований, 53, 1992, 342; Замбелли и др. Териогенология, 57, 2002а, 1981; Замбелли и др. Журнал кошачьей медицины и хирургии, 4, 2002b, 95; Замбелли и Прати, 2006 г.; Лопате Териогенология, 70, 2008, 397; Темы Дэвидсона и Бейкера в медицине животных-компаньонов, 24, 2009, 55).Ультрасонографическое измерение внеплодных и плодных структур является распространенным и точным методом прогнозирования дня родов во время беременности, когда используются специфические формулы в зависимости от ультразвукового параметра, вида и, у собак, размера суки (Шилле и Gontarek Journal of the American Veterinary Medical Association, 187, 1985, 1021; England et al. Journal of Small Animal Practice, 31, 1990, 324; Luvoni and Grioni Journal of Small Animal Practice, 41, 2000, 292; Luvoni and Beccaglia Reproduction. in Domestic Animals, 41, 2006, 27; Lopate Theriogenology, 70, 2008, 397; Michel et al. Репродукция домашних животных, 46, 2011, 926; Beccaglia и Luvoni Reproduction in Domestic Animals, 47, 194, 2012). Недавние исследования показали, что у собак приближение родов можно предсказать путем оценки потока плода и частоты сердечных сокращений плода с помощью ультразвука (Gil et al. Theriogenology, 82, 2014, 933; Giannico et al., Animal Reproduction Science, 154, 2015, 105). Для точного предсказания даты родов желательно сочетание различных методов.

    Внутриутробная трансплантация гемопоэтических стволовых клеток у собак: изучение окна возможностей максимального приживления трансплантата в гестационном возрасте — Полный текст — Диагностика и терапия плода 2013, Vol.33, No. 2

    Объектив: Внутриутробная трансплантация гемопоэтических стволовых клеток (ВГСК) является многообещающим методом лечения различных врожденных заболеваний. Нашей целью было определить оптимальное время беременности для IUHSCT на собачьей модели. Методы: ВГСК проводилась на 31-50-й день (63-й срок) плода клыков с использованием клеток CD34+, выделенных из костного мозга отца в дозах 0,09-3,4 × 10 9 CD34+ клеток/кг и Т-клеток (CD3+/CD5+ ) из отцовской крови в 0. 11-1,1 × 10 9 клеток/кг. Приживление оценивали с помощью анализа химеризма на основе ПЦР (обнаружение гена SRY для женщин-реципиентов и уникальные микросателлитные локусы для обоих полов). Результаты: Микрохимеризм и химеризм присутствовали у нескольких реципиентов на большинстве сроков беременности на момент трансплантации. Максимальное приживление получено в кроветворных тканях при трансплантациях, выполненных на 42-е сутки. В крайних случаях гестационного возраста реципиента приживление трансплантата было минимальным или отсутствовало. Заключение: Возраст плода во время IUHSCT играет важную роль в достижении приживления трансплантата в нашей модели собаки.

    © 2013 S. Karger AG, Базель

    Введение

    Многих осложнений и ограничений, связанных с постнатальной трансплантацией костного мозга (ТКМ), можно избежать, используя внутриутробную трансплантацию гемопоэтических стволовых клеток (IUHSCT). Кандидаты на заболевания, которые кажутся многообещающими для применения IUHSCT у людей, включают многие врожденные ферментные, гематологические и иммунные дефициты [1,2]. Осложнения постнатальной ТКМ включают токсичность необходимой иммуносупрессивной терапии и реакцию «трансплантат против хозяина» (РТПХ). Кроме того, менее чем у 25% реципиентов будет HLA-совместимый донор.

    Ограниченное приживление было основным препятствием в предыдущих попытках IUHSCT человека. На сегодняшний день единственные явные успехи были достигнуты при тяжелом комбинированном иммунодефиците, связанном с Х-хромосомой, вероятно, вторичном по отношению к конкурентному преимуществу донорских клеток [3,4]. Мы разработали модель IUHSCT у плодов клыков [5], у которых, как и у людей, развивается иммунокомпетентность до рождения [6], чтобы исследовать роль дозировки донорских клеток и гестационного возраста в приживлении трансплантата и РТПХ.Это исследование является продолжением нашей работы, предназначенной для определения оптимального гестационного возраста для сроков IUHSCT.

    Развитие иммунной системы плода собак имеет сходство с человеческим, что имеет отношение к доклинической модели IUHSCT [6]. В отличие от грызунов, собаки кажутся иммунологически зрелыми при рождении [7]. Плоды собак впервые обнаруживают распознавание бактериофагов на 40-й день гестации (63-й день доношенности), несмотря на то, что в этом возрасте отсутствует периферия лимфоидных клеток [8].Периферализация лимфоцитов начинает происходить на 45-50 сутки [7]. Тимэктомия собаки в возрасте 48 дней беременности вызывает дефицит гуморальных антител и клеточные реакции гиперчувствительности [9]. Самая ранняя выявляемая продукция антител происходит примерно на 56-й день [8].

    В предыдущей работе других авторов было предложено «окно возможностей» гестационного возраста, которое позволяет успешно приживить трансплантат и избежать РТПХ после IUHSCT [10]. «Окно возможностей» для IUHSCT должно предшествовать установлению иммунологической компетентности хозяина.С другой стороны, IUHSCT, выполненная слишком рано, может быть менее успешной во время быстрой клеточной экспансии гемопоэтических клеток плода-хозяина. Цель этого исследования состояла в том, чтобы изучить оптимальное время беременности для IUHSCT на собачьей модели.

    Материалы и методы

    Животные

    Восемь пар племенных животных (пары мать-отец) были закуплены (из одобренных Американской ассоциацией по аккредитации учреждений по уходу за лабораторными животными) для IUHSCT на 31-50 дни после оплодотворения (день срока 63). ).Эта работа была выполнена в соответствии с протоколом ухода за животными, одобренным Школой медицины Университета Джона Хопкинса. Ветеринар в Университете Джонса Хопкинса сертифицирован Американской ассоциацией по аккредитации в области ухода за лабораторными животными и соответствует рекомендациям по надлежащему уходу за животными, установленным Американской ветеринарной медицинской ассоциацией.

    Подготовка HSC донора

    КМ собаки от донора-отца был собран за день до запланированной IUHSCT. Под общей анестезией аспирировали костный мозг из длинных костей и бедер мужчины-донора.Мононуклеарные клетки выделяли из донорского костного мозга с использованием градиента Фиколла и метили мышиным анти-собачьим IgG1 против CD34 (клон 1H6; FHCRC, Сиэтл, Вашингтон, США), а затем крысиными анти-мышиными микробусинами. Затем проводили селекцию CD34+ с использованием магнитной колонки (Miltenyi Biotec, Оберн, Калифорния, США), и положительную фракцию использовали для трансплантации. Альтернативно, для трансплантации использовали фиколловую фракцию ВМ, в которой рассчитывали процент клеток CD34+ и количество фиколлированных клеток корректировали для достижения желаемой дозы CD34+ клеток/кг.Аликвоты каждой стадии очистки сохраняли и анализировали на чистоту с помощью проточной цитометрии с использованием мышиного анти-собачьего CD34 (клон 2E9; Фарминген, Сан-Диего, Калифорния, США), непосредственно конъюгированного с фикоэритрином для анализа FACS (сортировка клеток, активируемая флуоресценцией). Для каждого эксперимента мы стремились использовать высокую дозу донорских клеток CD34+ на килограмм, которая имела тенденцию к снижению по мере увеличения гестационного возраста и массы плода (таблица 1).

    Таблица 1

    Дозы донорских клеток и постнатальные анализы из 8 IHSCT через 31–50 дней после оплодотворения (@Tx)

    Подготовка донорских Т-клеток

    Периферическую кровь отцовского донора собак собирали за день до запланированного сбора костного мозга. Мы стремились достичь доз Т-клеток от 1 × 10 90 229 8 90 230 до 1 × 10 90 229 9 90 230 клеток/кг. Используя градиент Ficoll, мононуклеарные клетки выделяли из донорского костного мозга и метили с использованием мышиного анти-собачьего IgG1, а затем крысиных анти-мышиных микрошариков. Затем проводили селекцию CD3+ с использованием магнитной колонки (Miltenyi Biotec) и собирали положительную фракцию. Были получены аликвоты и проанализированы на чистоту с помощью проточной цитометрии с использованием анти-собачьих CD3 и CD5, непосредственно конъюгированных с изотиоцианатом флуоресцеина и фикоэритрином, соответственно, для анализа FACS.В день трансплантации CD34+ и Т-клетки промывали, пересчитывали, оценивали на жизнеспособность и смешивали в желаемых дозах. Дозы Т-клеток варьировались от 1,1 × 10 8 до 1,1 × 10 9 Т-клеток/кг.

    Процедура IUHSCT

    По прибытии беременной суки была проведена чрескожная эхография для проверки гестационного возраста и жизнеспособности [11]. Через 31–50 дней после оплодотворения под общей анестезией выполняли лапаротомию, чтобы обнажить матку и сделать интраоперационную сонографию с использованием строгой асептической техники.Длина темени-крестца плода в этом исследовании колебалась от 1,9 до 10,6 см. С использованием установленных норм оценивали массу плода (формула: L = 21W 0,389 ) [12]. Затем под ультразвуковым контролем выполняли внутрибрюшинные инъекции плода с использованием ГСК и Т-клеток (исследуемые животные) или этиодолового красителя (контроль) [5]. От 1 до 4 детенышей в помете служили реципиентами в зависимости от количества донорских клеток, собранных во время сбора отцовского BM. Сердцебиение плода было подтверждено, брюшная полость закрыта.Для оценки жизнеспособности и роста плода после трансплантации проводили серийную трансдермальную сонографию. При рождении каждого детеныша была получена рентгенограмма для определения наличия (контрольный щенок) или отсутствия (щенок-реципиент) внутрибрюшинного рентгеноконтрастного этиодола.

    Послеродовые исследования приживления трансплантата и РТПХ

    После умерщвления в течение первых нескольких дней жизни было проведено вскрытие щенков-реципиентов и контрольных детенышей. Образцы тканей были отправлены на гистологию и анализ приживления ДНК, включая кроветворные ткани (кровь, костный мозг, печень, селезенка и тимус), мозг, почки, сердце и ткани, где наиболее вероятно развитие РТПХ (кожа, толстая кишка и язык). ).

    TaqMan SRY Количественная ПЦР. Для количественной оценки степени приживления трансплантата у женщин-реципиентов трансплантата использовали количественный анализ ПЦР, специфичный для гена SRY (на Y-хромосоме). Дублированные реакции готовили с использованием 2-кратной мастер-микса ПЦР в реальном времени (Applied Biosystems, Фостер-Сити, Калифорния, США), прямого праймера = CCCCATGAACGCATTCTTG, обратного праймера = CTGATCTCTGAGTTTTGCATTTGG и зонда = TCTCGCGATCAAAGG, меченного на 5′-конце FAM и на 3′-конце с NFQ.Количественную оценку проводили путем сравнения со стандартной кривой. Количественный анализ в режиме реального времени был разработан для контрольного гена (фактор V) для контроля количества и качества ДНК из различных тканей. Анализ имеет линейный диапазон обнаружения от 100 до 0,01%.

    Реакции микросателлитной ПЦР. Для количественной оценки степени приживления трансплантата у реципиентов любого пола проводили микросателлитную ПЦР и капиллярный электрофорез с использованием реагентов для флуоресцентной ПЦР StockMarks (Applied Biosystems).Десять микросателлитных локусов амплифицировали в двух повторностях из образцов ДНК отца, матери и детеныша. Продукты ПЦР анализировали на генетическом анализаторе ABI 3100 (Applied Biosystems). Аллели отца, матери и детеныша идентифицировали и сравнивали с выбранными «информативными» микросателлитными локусами, по которым потенциально можно было бы идентифицировать уникальные аллели донора, если бы произошло приживление. В каждом из информативных локусов данные капиллярного электрофореза детенышей оценивали на наличие уникальных аллелей донора. Количественную оценку проводили путем сравнения высоты пиков уникальных донорных аллелей с высотами пиков аллелей щенков. Формальный предел обнаружения для этого анализа составляет 5%; однако истинный предел обнаружения для отдельной реакции зависит как от локуса, так и от ПЦР. Хотя приживление часто можно обнаружить ниже 5%, количественная оценка на этом уровне не так точна.

    Статистический анализ

    Основной статистической целью данного исследования было определение оптимального времени для ВТГСК путем сравнения приживления трансплантата в зависимости от гестационного возраста и в различных тканях-мишенях.Пометы были разделены на три категориальные группы: ранние (31–37 дней), средние (38–46 дни) и поздние (47–50 дни). уровень приживления в каждой группе в различных тканях-мишенях. Для сравнения диапазона приживления внутри групп использовали тест экстремальной реакции Мозеса. Значения p < 0,05 считались статистически значимыми.

    Результаты

    Мы провели 8 экспериментов IUHSCT на собаках в гестационном возрасте, указанном в таблице 1. Дозы ГСК варьировали от 0,09 до 3,4 × 10 9 CD34+ клеток/кг. Дозы Т-клеток (CD3+/CD5+) варьировали от 1,1 × 10 8 до 1,1 × 10 9 клеток/кг. Чистота CD34+, определенная с помощью анализа FACS, находилась в диапазоне от 50 до 78% и использовалась для расчета дозы CD34+ в клетках на килограмм. Общая досрочная выживаемость детенышей в этих экспериментах составила 85% (44/52 животных). Выживаемость у реципиентов была аналогичной: 20/21 (95%) дожили до рождения. Эта скорость выживания согласуется с предыдущей работой с использованием этой модели [5].Во всех случаях были выявлены контрольные крысята (по внутрибрюшинному наличию этиодола). В общей сложности было 20 новорожденных-реципиентов, ткани которых оценивали на предмет приживления и гистологических признаков РТПХ (таблица 1). Ни в одном из случаев IUHSCT не было отмечено клинических или гистологических признаков РТПХ.

    Мы наблюдали микрохимеризм в некроветворных органах у всех, кроме реципиентов трансплантата на 31-й день. Более высокие уровни приживления наблюдались в кроветворных тканях (диапазон 0-10%). Когда приживление в гемопоэтических тканях сравнивали с гестационным возрастом во время IUHSCT, мы наблюдали тенденцию к более высоким уровням приживления в среднем диапазоне нашего гестационного возраста с пиком в среднем диапазоне гестационного возраста.Возможно, что более важно, эта же тенденция наблюдалась, когда мы анализировали приживление только цельной крови и костного мозга. Приживление достигло пика на 42-й день беременности во время IUHSCT с приживлением как в крови, так и в костном мозге 7,5%. В крайних пределах нашего гестационного возраста приживление практически отсутствовало, несмотря на более высокие дозы донорских клеток в более раннем возрасте плода. Данные по всем получателям представлены в таблице 2; женщины-реципиенты были проанализированы с помощью количественной ПЦР SRY и микросателлитной ПЦР с хорошим соответствием между двумя методами; реципиентов мужского пола можно было анализировать только с помощью микросателлитной ПЦР.

    Таблица 2

    Результаты приживления по типу ткани через 31–50 дней после оплодотворения

    Когда пометы были стратифицированы на группы, средний процент приживления различался между субъектами на ранних, средних и поздних стадиях только для селезенки и крови (p = 0,047 и р = 0,026 соответственно (табл. 3). Для селезенки единственное различие, которое является статистически значимым при подготовке категорий, находится между ранним и средним (p = 0,020), и это различие больше не является значимым после поправки на множественные сравнения (p = 0.059; таблицу 4). Нет существенной разницы между ранним и поздним, или между средним и поздним. Для крови процент приживления значительно выше в средней категории, чем в ранней категории (p = 0,007 и p = 0,021, соответственно, после поправки на множественные сравнения; таблица 4). Нет существенной разницы между ранним и поздним, или между средним и поздним. Используя тест экстремальной реакции Мозеса, единственным значимым результатом было обнаружение крови: средняя группа имела более широкий диапазон, чем ранняя группа (p < 0. 001).

    Таблица 3

    Медиана и квартиль приживления по тканям для каждой категории помета

    Таблица 4

    Сравнение подгрупп селезенки и крови Хотя ранние попытки на людях были ограничены минимальным приживлением трансплантата, результаты исследований на животных были обнадеживающими [13]. Чтобы перейти к испытаниям на людях, необходимы доклинические модели на животных.

    Теоретические преимущества IUHSCT многочисленны. (1) IUHSCT может избежать серьезных краткосрочных и долгосрочных осложнений, связанных с подготовительными режимами и иммуносупрессией, необходимыми для приживления донорских клеток при постнатальной ТКМ. (2) Ранний человеческий плод еще не развил иммунокомпетентность, поэтому повышенная толерантность к чужеродным клеткам может способствовать приживлению даже у доноров, не совместимых по HLA. (3) При сниженной экспрессии HLA плода на ранних сроках беременности и в стерильной среде плода вероятность развития РТПХ может быть ниже.(4) Низкоуровневое приживление может быть излечивающим или позволять постнатальную трансплантацию клеток от того же донора путем индукции толерантности хозяина. (5) IUHSCT может избежать повреждения органов-мишеней, которое происходит антенатально при ряде заболеваний, если выполняется на достаточно раннем сроке гестации [14].

    Модель на собаках имеет несколько очевидных преимуществ по сравнению с другими моделями IUHSCT на крупных животных. (1) Наличие собачьих антител к CD34 позволяет очищать HSC от донорского BM [15]. (2) Наличие собачьих антител к CD3 и CD5 позволяет производить очистку Т-клеток из периферической крови [16].(3) Собаки имеют относительно короткий срок беременности по сравнению с другими моделями животных. (4) Размер собачьего помета позволяет проводить несколько инфузий плода в течение одной и той же беременности. (5) У собак мало акушерских осложнений, а их матка устойчива к хирургическим манипуляциям. (6) Будущие испытания лечения и моделирование для применения на людях возможны, потому что у собак много аналогичных заболеваний [17,18].

    Используя эту модель, наши результаты показывают, что возраст плода на момент введения ГСК отцовского происхождения может играть ключевую роль в достижении приживления трансплантата. По нашим данным, окно гестационного возраста около 42 дней может обеспечить максимальную возможность приживления без РТПХ у плода клыка. Однако одним из основных ограничений этого исследования было отсутствие долгосрочного наблюдения за потомством реципиента. Более длительный период наблюдения позволил бы определить долговременное приживление трансплантата, восстановление иммунитета и провести лучший анализ признаков РТПХ, включая определение того, мог ли наблюдаемый дисбаланс уровней донорских клеток в периферической крови по сравнению с КМ представлять собой ранняя РТПХ.Теоретически уровни приживления, наблюдаемые в крови в середине гестационного возраста, приближались к уровням, которые, если они сохранялись, могли быть терапевтическими при гемоглобинопатиях [19,20]. При очень коротком периоде наблюдения трудно установить приживление/восстановление ГСК. Линии SRY-позитивных клеток могут представлять клетки-предшественники или остаточные донорские клетки, а не привитые HSC. Еще одним ограничением этого исследования являются технические трудности в экстремальных условиях беременности. На ранних сроках беременности эта процедура технически сложна, а на более поздних сроках беременности добиться достаточно высоких доз клеток затруднительно.Это привело к тому, что несколько реципиентов находились на крайних сроках беременности, и может быть объяснением наблюдаемых различий в приживлении.

    IUHSCT может создать химеризм низкого уровня при рождении, что позволило донор-специфической толерантности HCST «повысить» трансплантат BM у минимально кондиционированного животного, обращая вспять летальный фенотип дефицита адгезии лейкоцитов у собак [21]. Это отклонение от нашего протокола важно, потому что доза клеток CD34, которую мы использовали, вряд ли будет достижима при лечении человека.

    Наша работа поддерживает концепцию о том, что на ранних сроках гестации быстрая пролиферация гемопоэтических клеток плода-хозяина может препятствовать приживлению трансплантата [22]. Однако на более поздних сроках гестации созревание иммунологического ответа плода может привести к отторжению трансплантата. У собак иммунное созревание почти завершается между 45 и 55 днями, и в это же время BM становится сильно клеточным с обилием HSCs [6]. Несмотря на отсутствие обширных данных, это соответствует возрасту человеческого плода 16-20 недель, расчетному гестационному возрасту, при котором возможно вмешательство плода [6].Окно беременности, в котором пролиферация клеток-хозяев замедляется, но места для донорских клеток все еще доступны и/или развиваются, может указывать оптимальное время для выполнения IUHSCT [22].

    В будущих исследованиях основное внимание будет уделено дозированию клеток в пределах окна гестационного возраста 38–46 дней для определения параметров максимального приживления трансплантата в этой модели IUHSCT у млекопитающих. В рамках этих исследований гестационного возраста будет важно поддерживать фиксированную дозу клеток как CD34, так и числа Т-клеток, чтобы обеспечить точное определение оптимального гестационного возраста.Другие области исследований будут включать долгосрочные исследования приживления трансплантата и попытки определить клеточные дозы, которые достигают РТПХ на собачьей модели. В конечном счете, мы надеемся проверить терапевтический потенциал приживления, достигнутый с помощью IUHSCT, на собачьих моделях заболеваний человека. Исследования на животных моделях, таких как собаки, обеспечат основу для продвижения IUHSCT к применению на людях.

    Благодарность

    Исследование было поддержано Национальным институтом здравоохранения, грант No.R01AI055683.

    Авторское право: Все права защищены. Никакая часть данной публикации не может быть переведена на другие языки, воспроизведена или использована в любой форме и любыми средствами, электронными или механическими, включая фотокопирование, запись, микрокопирование или любую систему хранения и поиска информации, без письменного разрешения издателя. .
    Дозировка препарата: авторы и издатель приложили все усилия, чтобы гарантировать, что выбор препарата и дозировка, указанные в этом тексте, соответствуют текущим рекомендациям и практике на момент публикации.Тем не менее, в связи с продолжающимися исследованиями, изменениями в правительственных постановлениях и постоянным потоком информации, касающейся лекарственной терапии и реакций на лекарства, читателю настоятельно рекомендуется проверять вкладыш в упаковке для каждого лекарства на предмет любых изменений в показаниях и дозировке, а также для дополнительных предупреждений.

    Добавить комментарий

    Ваш адрес email не будет опубликован.